BBa_K1690000 1 BBa_K1690000 Mating pheromone (S. cerevisiae) 2015-09-15T11:00:00Z 2015-09-17T05:33:39Z Obtained from the genome of S. cerevisiae [MF(ALPHA)1 locus]. This is a coding sequence of S. cerevisiae mating pheromone together with a secretion tag. Expression in the yeast cell causes secretion of the mature mating pheromone into the medium. false false _2108_ 25090 25090 9 false In the genome, the secretion tag is followed by a three copies of the coding sequence for the actual peptide. We had to amplify only the secretion tag first, and then added the DNA sequence of the peptide using different reverse primer. false Anna Sosnova, Pavel Zach annotation2461259 1 Pheromone range2461259 1 275 312 annotation2461250 1 start range2461250 1 7 9 annotation2461253 1 Kozak range2461253 1 1 6 annotation2461258 1 Secretion tag range2461258 1 10 274 annotation2461256 1 stop range2461256 1 313 315 BBa_K1690000_sequence 1 tacaaaatgagatttccttcaatttttaccgcagttttattcgcagcatcctccgcattagctgctccagtcaacactacaacagaagatgaaacggcacaaattccggctgaagctgtcatcggttacttagatttagaaggggatttcgatgttgctgttttgccattttccaacagcacaaataacgggttattgtttataaatactactattgccagcattgctgctaaagaagaaggggtatctttggataaaagagaggctgaagcttggcattggttgcaactaaaacctggccaaccaatgtactaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z