BBa_K1690001 1 BBa_K1690001 Mating pheromone (C. albicans) 2015-09-16T11:00:00Z 2015-09-17T05:33:58Z The secretion tag was obtained by a genomic PCR from S. cerevisiae. The pheromone sequence was synthetized. This is a coding sequence of C. albicans mating pheromone together with a secretion tag. Expression in the yeast cell causes secretion of the mature mating pheromone into the medium. Cells with a corresponding STE2 receptor react to this pheromone by the activation of the pheromone mating pathway. Detailed description can be obtained from the [http://2015.igem.org/Team:Czech_Republic/Project/Synthetic_signals_and_receptors#Signals iGEM 2015 Czech Republic wiki]. false false _2108_ 25090 25090 9 false This part is derived from [http://parts.igem.org/Part:BBa_K1690000 BBa_K1690000]. Using site-directed mutagenesis, we replaced the original pheromone sequence. false Anna Sosnova, Pavel Zach annotation2464288 1 start range2464288 1 7 9 annotation2464306 1 Pheromone range2464306 1 276 312 annotation2464289 1 Secretion tag range2464289 1 10 275 annotation2464307 1 stop range2464307 1 313 315 annotation2464287 1 Kozak range2464287 1 1 6 BBa_K1690001_sequence 1 tacaaaatgagatttccttcaatttttaccgcagttttattcgcagcatcctccgcattagctgctccagtcaacactacaacagaagatgaaacggcacaaattccggctgaagctgtcatcggttacttagatttagaaggggatttcgatgttgctgttttgccattttccaacagcacaaataacgggttattgtttataaatactactattgccagcattgctgctaaagaagaaggggtatctttggataaaagagaggctgaagctggcttccgtttaacaaattttggatatttcgaacctggttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z