BBa_K1690003 1 BBa_K1690003 Mating pheromone (L. elongisporus) 2015-09-16T11:00:00Z 2015-09-17T05:34:23Z This part is derived from [http://parts.igem.org/Part:BBa_K1690000 BBa_K1690000]. Using site-directed mutagenesis, we replaced the original pheromone sequence. This is a coding sequence of L. elongisporus mating pheromone together with a secretion tag. Expression in the yeast cell causes secretion of the mature mating pheromone into the medium. Cells with a corresponding STE2 receptor react to this pheromone by the activation of the pheromone mating pathway. Detailed description can be obtained from the [http://2015.igem.org/Team:Czech_Republic/Project/Synthetic_signals_and_receptors#Signals iGEM 2015 Czech Republic wiki]. false false _2108_ 25090 25090 9 false The secretion tag was obtained by a genomic PCR from S. cerevisiae. The pheromone sequence was synthetized. false Anna Sosnova, Pavel Zach annotation2464323 1 stop range2464323 1 313 315 annotation2464313 1 Kozak range2464313 1 1 6 annotation2464315 1 Secretion tag range2464315 1 10 275 annotation2464314 1 start range2464314 1 7 9 annotation2464322 1 Pheromone range2464322 1 276 312 BBa_K1690003_sequence 1 tacaaaatgagatttccttcaatttttaccgcagttttattcgcagcatcctccgcattagctgctccagtcaacactacaacagaagatgaaacggcacaaattccggctgaagctgtcatcggttacttagatttagaaggggatttcgatgttgctgttttgccattttccaacagcacaaataacgggttattgtttataaatactactattgccagcattgctgctaaagaagaaggggtatctttggataaaagagaggctgaagctggttggatgtggacaagatatggaaggtttagtcctgtttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z