BBa_K1692033 1 BBa_K1692033 RFP gDNA 2015-09-16T11:00:00Z 2015-09-18T08:22:08Z Synthesized by Integrated DNA Technologies (IDT). We amplified the sequence, digested with EcoRI and SpeI and ligated into the PSB1C3 vector. This gene provides the intermediate for synthesizing gRNA targeting RFP (BBa_J04450). When used in conjuction with the CRISPR/Cas system, this gRNA will bind to and digest the RFP plasmid. false false _2110_ 26427 26511 9 false N/A false Kirsten Thompson BBa_K1692033_sequence 1 aattgtaatacgactcactatagggggtcacgagttcgaaatcgagttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z