BBa_K1695007 1 BBa_K1695007 S_mutant_21_co 2015-08-10T11:00:00Z 2015-08-22T05:03:54Z Bacteriphage 21 Bacteriphage 21 Mutant Holin Codon-optimized true false _2113_ 26585 26466 9 false Deletion of TMD1 & serine at position 41 (S68) to asparagine false Aruna Surendran Ramkrishnan BBa_K1695007_sequence 1 atggatcaggttagcccgagccagtgggcagcaattggtgttctgggtaacctggttctgggttttctgacctatctgaccaatctgtatttcaaaattcgtgaggatcgtcgtaaagcagcacgtggtgaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z