BBa_K1695008 1 BBa_K1695008 RBS + Bacteriophage 21 codon optimized S mutant gene 2015-08-10T11:00:00Z 2015-09-17T06:27:04Z Bacteriophage 21 Bacteriophage 21 Mutant Holin Codon-optimized with strong RBS false false _2113_ 26466 26466 9 false Deletion of TMD1 & serine at position 41 (S68) to asparagine Addition of strong RBS false Aruna Surendran Ramkrishnan annotation2435034 1 conserved range2435034 1 5 8 annotation2435036 1 BBa_K1695007 range2435036 1 19 153 annotation2435035 1 BBa_B0034 range2435035 1 1 12 BBa_K1695008_sequence 1 aaagaggagaaatactagatggatcaggttagcccgagccagtgggcagcaattggtgttctgggtaacctggttctgggttttctgacctatctgaccaatctgtatttcaaaattcgtgaggatcgtcgtaaagcagcacgtggtgaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z