BBa_K1695010 1 BBa_K1695010 RBS + Bacteriophage 21 S mutant gene 2015-08-10T11:00:00Z 2015-09-17T06:22:18Z Bacteriophage 21 Bacteriophage 21 Wild Type Mutant Holin with Strong RBS false false _2113_ 26466 26466 9 false Deletion of TMD1 & serine at position 41 (S68) to asparagine Addition of Strong RBS false Aruna Surendran Ramkrishnan annotation2435038 1 BBa_B0034 range2435038 1 1 12 annotation2435037 1 conserved range2435037 1 5 8 annotation2435039 1 BBa_K1695009 range2435039 1 19 153 BBa_K1695010_sequence 1 aaagaggagaaatactagatggatcaggtcagtccgtcacagtgggctgcgattggagtgcttggaaaccttgtgttgggttttctcacttatctgacaaatctgtatttcaaaatcagagaagacagacgaaaggctgcgagaggtgaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z