BBa_K1696013 1 BBa_K1696013 Mf-ssrA Tag1 2015-09-13T11:00:00Z 2015-09-15T09:16:11Z M. florum The M. florum ssrA tag (mf-ssrA) is degraded by its endogenous Lon protease (mf-Lon) but not by E. coli Lon or ClpXP, and mf-Lon does not recognize or degrade ec-ssrA, providing a protease and cognate degradation tag with orthogonal functionality in E. coli. false false _2114_ 16881 16881 9 false codon optimization false Yue Liu BBa_K1696013_sequence 1 gctgctaacaaaaacgaagaaaacaccaacgaagttccgaccttcatgctgaacgctggtcaggctaaccgtcgtcgtgtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z