BBa_K1696020 1 BBa_K1696020 tag6 for mf-lon to recognize 2015-09-14T11:00:00Z 2015-09-15T08:06:20Z M. florum weak tag for mf-lon to recognize false false _2114_ 16881 16881 9 false codon optimization false Yue Liu BBa_K1696020_sequence 1 gctgctaacaaaaacgaagaaaacaccaacgaagttccggacggtatgctgaacgctggtcaggctaaccgtcgtcgtgtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z