BBa_K1697000 1 SboA SboA from B.subtilis 168 2015-09-02T11:00:00Z 2016-02-03T10:03:43Z Genomic sequence of Bacillus subtilis 168 Subtilosin coding region without its operon false false _2115_ 4206 24798 9 true The operon for SboA is not included false UI Indonesia 2015 annotation2453084 1 TAA range2453084 1 130 132 annotation2453085 1 SboA range2453085 1 1 132 annotation2453083 1 ATG range2453083 1 1 3 BBa_K1697000_sequence 1 atgaaaaaagctgtcattgtagaaaacaaaggttgtgcaacatgctcgatcggagccgcttgtctagtggacggtcctatccctgattttgaaattgccggtgcaacaggtctattcggtctatgggggtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z