BBa_K1698002 1 BBa_K1698002 BaseHunter : Activated to become detector for 62bp target sequence on SRY gene 2015-09-17T11:00:00Z 2015-09-19T09:42:54Z 62bp Target is from SRY Gene. Accession code : NM_003140 Part may be activated by established protocol to become a detector plasmid for a 62bp Target sequence, found on the SRY gene, located on the Y chromosome. Further optimisation of part is needed for use in distinguishing male and female genomic DNA. Part is accurate in detecting target when isolated from a genomic sample. For protocol for construction of detector by digestion of plasmid see Wiki false false _2116_ 25118 22006 9 false Target sequence is flanked by HaeIII restriction sites. Digestion of a genomic sample with HaeIII yields fragments of the target size. false Leanne O Sullivan BBa_K1698002_sequence 1 gctcttcaccatgtcaagcgccccatgaatgcatttatgggtaccaataataaaagcttgtggtcccgtggtgagaggcacaagttggcactgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z