BBa_K1698004 1 BBa_K1698004 BaseHunter : Activated to become detector for 24bp target sequence on Mycobacterium genomes 2015-09-17T11:00:00Z 2015-09-19T09:14:29Z Part is non-coding. It was prepared by sequencing and ligation into PSB1C3 Once the part BBa_K1698004 is digested with the four enzymes as described in our protocols, it can be used as a detector for TB or through modification for other mycobacterial species false false _2116_ 25118 25118 9 false For the detailed design of this sequence, we just had to make sure that the complementary target would not form hairpin structures or dimerize and would have a rather low GC content false Brandon Malone BBa_K1698004_sequence 1 gctcttctcagccttcccggtacctaattcggatccgctggctaccccactgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z