BBa_K1701002 1 PcotC PcotC 2015-09-07T11:00:00Z 2015-09-17T09:36:55Z http://www.ncbi.nlm.nih.gov/nuccore/223666305?report=genbank&to=4214598 The PcotC gene is the promoter of the CotC gene, and the CotC gene codes for the protein CotC. false false _2119_ 21319 21319 9 false None false Wei Wei BBa_K1701002_sequence 1 gataaatcgtttgggccgatgaaaaatcggctctttattttgatttgtttttgtgtcatctgtctttttctatcatttggacagcccttttttccttctatgattttaactgtccaagccgcaaaatctactcgccgtataataaagcgtagtaaaaataaaggaggagtatat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z