BBa_K1705012 1 BBa_K1705012 pCHU_1284 2015-09-17T11:00:00Z 2015-09-24T07:28:41Z genomic sequence promoter to be used with the bacterium Cytophaga hutchinsonii false false _2124_ 27569 27565 9 false Not well known bacterium false Wendi Guraziu annotation2476932 1 BsaI Site range2476932 1 67 72 annotation2476934 1 MoClo Fusion Site A range2476934 1 8 11 annotation2476933 1 MoClo Fusion Site B range2476933 1 62 65 annotation2476935 1 pCHU_1284 range2476935 1 12 61 annotation2476931 1 BsaI Site range2476931 1 1 6 BBa_K1705012_sequence 1 ggtctcaggagtattgatagatatgtaaatctttttgttttactttgtggtataaacaagatactagagacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z