BBa_K1707013 1 BBa_K1707013 cI857 under the control of RNA thermometer 2015-09-13T11:00:00Z 2015-09-19T04:53:35Z This part is the result of the assembly of existing parts. The translation of the thermosensitive cI repressor (cI857) is placed under the control of an RNA thermometer. This construction allows the controlled repression of the expression of a gene A with a cI promoter within the 30-35??C range of temperature. Below 30??C, the secondary structure formed by the RNA thermometer in the mRNA prevents the translation of cI857, A is therefore expressed. Above 30??C, the RNA thermometer is unfolded, allowing the translation of cI857. Under 35??, this later is properly folded and active, repressing the expression of A. Above 35??C, cI857 is under an inactive form and A is expressed. false false _2127_ 28262 14164 9 false During the design, we had to make sure that the RBS included in the RNA thermometer would be at a correct location in front of the cI857 gene when we will assemble the parts. Luckily, the RNA thermometer part (K115017) had been designed to allow the assembly with protein coding part. false Sylvie Lautru, Audrey Moatti annotation2454569 1 cIts range2454569 1 119 832 annotation2454570 1 BBa_K098997 range2454570 1 119 832 annotation2454566 1 BBa_J23101 range2454566 1 1 35 annotation2454571 1 BBa_B0015 range2454571 1 841 969 annotation2454568 1 SD range2454568 1 112 117 annotation2454567 1 BBa_K115017 range2454567 1 36 118 BBa_K1707013_sequence 1 tttacagctagctcagtcctaggtattatgctagcccgggcgcccttcgggggcccggcggagacgggcgccggaggtgtccgacgcctgctcgtccagtctttgctcagtggaggatatgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggctgatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z