BBa_K1709000 1 LuxI-His LuxI-His 2015-09-07T11:00:00Z 2015-09-18T04:12:52Z Sequence is originating from V. fischeri. Here, the sequence from BBa_C0061 was used and optimized. Autoinducer synthetase for acyl-homoserine lactones (AHL): LuxI synthesizes AHL (3OC6HSL). Two molecules of AHL form a complex with two molecules of the LuxR protein. This complex then binds to a palyndromic site on the lux promoter, increasing its transcription rate. LuxI, LuxR and the right lux promoter are all derived from V. fischeri. In absence of AHL, the right lux promotor only gives weak constitutive expression of downstream genes. The LuxI gene is fused to a His-tag facilitating gene expression measurements. false false _2129_ 25389 25389 9 true Biobrick BBa_C0061 still contained a Barcode sequence which was deleted. For our own use, 5 bp were exchanged to create unique restriction sites and to optimize DNA folding. false Astrid Deryckere annotation2446990 1 LuxI Coding Region range2446990 1 1 579 annotation2446991 1 Polyhistidine-tag range2446991 1 583 606 annotation2446989 1 ATG Start Codon range2446989 1 1 3 annotation2446992 1 Ochre Stop Codon range2446992 1 607 609 BBa_K1709000_sequence 1 atgactataatgataaaaaaatcggattttttggcaattccatcggaagagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactcaaatgcagaatatatttatgcttgtgatgatactgaaaatgtaagtggatgctggcgtttattacctacaacaggtgattatatgctgaaaagtgtttttcctgaattgcttggtcaacagagtgctcccaaagatcctaatatagtcgaattaagtcgttttgctgtaggtaaaaatagctcaaagataaataactctgctagtgaaattacaatgaaactatttgaagctatatataaacacgctgttagtcaaggtattacagaatatgtaacagtaacatcaacagcaatagagcgatttttaaagcgtattaaagttccttgtcatcgtattggagacaaagaaattcatgtattaggtgatactaaatcggttgtattatccatgcccatcaatgaacagtttaaaaaagcagtcttaaattcacaccatcaccatcaccatgccgcataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z