BBa_J61104 1 BBa_J61104 Ribosome Binding Site Family Member 2007-04-23T11:00:00Z 2015-08-31T02:03:00Z N/A {{JCA_Arkin_RBSFamily}} false false _95_ 0 483 95 In stock false N/A false John Anderson BBa_K1709001 1 BBa_K1709001 LuxI-His 2015-09-07T11:00:00Z 2015-09-26T09:17:10Z Sequence is originating from V. fischeri. Here, the sequence from BBa_C0061 was used and optimized. Autoinducer synthetase for acyl-homoserine lactones (AHL): LuxI synthesizes AHL (3OC6HSL). Two molecules of AHL form a complex with two molecules of the LuxR protein. This complex then binds to a palyndromic site on the lux promoter, increasing its transcription rate. LuxI, LuxR and the right lux promoter are all derived from V. fischeri. In absence of AHL, the right lux promotor only gives weak constitutive expression of downstream genes. The LuxI gene is fused to a His-tag facilitating gene expression measurements. false false _2129_ 25069 25389 9 true Biobrick BBa_C0061 still contained a Barcode sequence which was deleted. Also, a Ribosome Binding Site was added. For our own use, 5 bp were exchanged to create unique restriction sites and to optimize DNA folding. false Astrid Deryckere component2473568 1 BBa_K1709000 component2473563 1 BBa_J61104 annotation2473568 1 BBa_K1709000 range2473568 1 19 627 annotation2473563 1 BBa_J61104 range2473563 1 1 12 BBa_K1709000 1 LuxI-His LuxI-His 2015-09-07T11:00:00Z 2015-09-18T04:12:52Z Sequence is originating from V. fischeri. Here, the sequence from BBa_C0061 was used and optimized. Autoinducer synthetase for acyl-homoserine lactones (AHL): LuxI synthesizes AHL (3OC6HSL). Two molecules of AHL form a complex with two molecules of the LuxR protein. This complex then binds to a palyndromic site on the lux promoter, increasing its transcription rate. LuxI, LuxR and the right lux promoter are all derived from V. fischeri. In absence of AHL, the right lux promotor only gives weak constitutive expression of downstream genes. The LuxI gene is fused to a His-tag facilitating gene expression measurements. false false _2129_ 25389 25389 9 true Biobrick BBa_C0061 still contained a Barcode sequence which was deleted. For our own use, 5 bp were exchanged to create unique restriction sites and to optimize DNA folding. false Astrid Deryckere annotation2446990 1 LuxI Coding Region range2446990 1 1 579 annotation2446989 1 ATG Start Codon range2446989 1 1 3 annotation2446992 1 Ochre Stop Codon range2446992 1 607 609 annotation2446991 1 Polyhistidine-tag range2446991 1 583 606 BBa_J61104_sequence 1 aaagaagggaca BBa_K1709001_sequence 1 aaagaagggacatactagatgactataatgataaaaaaatcggattttttggcaattccatcggaagagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactcaaatgcagaatatatttatgcttgtgatgatactgaaaatgtaagtggatgctggcgtttattacctacaacaggtgattatatgctgaaaagtgtttttcctgaattgcttggtcaacagagtgctcccaaagatcctaatatagtcgaattaagtcgttttgctgtaggtaaaaatagctcaaagataaataactctgctagtgaaattacaatgaaactatttgaagctatatataaacacgctgttagtcaaggtattacagaatatgtaacagtaacatcaacagcaatagagcgatttttaaagcgtattaaagttccttgtcatcgtattggagacaaagaaattcatgtattaggtgatactaaatcggttgtattatccatgcccatcaatgaacagtttaaaaaagcagtcttaaattcacaccatcaccatcaccatgccgcataa BBa_K1709000_sequence 1 atgactataatgataaaaaaatcggattttttggcaattccatcggaagagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactcaaatgcagaatatatttatgcttgtgatgatactgaaaatgtaagtggatgctggcgtttattacctacaacaggtgattatatgctgaaaagtgtttttcctgaattgcttggtcaacagagtgctcccaaagatcctaatatagtcgaattaagtcgttttgctgtaggtaaaaatagctcaaagataaataactctgctagtgaaattacaatgaaactatttgaagctatatataaacacgctgttagtcaaggtattacagaatatgtaacagtaacatcaacagcaatagagcgatttttaaagcgtattaaagttccttgtcatcgtattggagacaaagaaattcatgtattaggtgatactaaatcggttgtattatccatgcccatcaatgaacagtttaaaaaagcagtcttaaattcacaccatcaccatcaccatgccgcataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z