BBa_R0062 1 lux pR Promoter (luxR & HSL regulated -- lux pR) 2003-01-31T12:00:00Z 2015-05-08T01:14:15Z <em>V. fischeri</em> Released HQ 2013 Promoter activated by LuxR in concert with HSL</p> <p>The lux cassette of V. fischeri contains a left and a right promoter. The right promoter gives weak constitutive expression of downstream genes.This expression is up-regulated by the action of the LuxR activator protein complexed with the autoinducer, 3-oxo-hexanoyl-HSL. Two molecules of LuxR protein form a complex with two molecules of the signalling compound homoserine lactone (HSL). This complex binds to a palindromic site on the promoter, increasing the rate of transcription. false true _1_ 0 24 7 In stock false <P> <P>This promoter is based on the <em>Vibrio fischeri </em>quorum sensing gene promoters. Two genes LuxI and LuxR and transcribed in opposite directions as shown below. The original sequence from which the parts <bb_part>BBa_R0062</bb_part> and <bb_part>BBa_R0063</bb_part> were derived is shown in the picture below. <p><img src="<bb_file>Image1.gif</bb_file>" width="614" height="362"><P> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr annotation7070 1 BBa_R0062 range7070 1 1 55 annotation2045 1 LuxR/HSL range2045 1 1 20 annotation2048 1 start range2048 1 53 53 annotation2047 1 -10 range2047 1 42 47 annotation2046 1 -35 range2046 1 20 25 BBa_B1002 1 BBa_B1002 Terminator (artificial, small, %T~=85%) 2006-08-29T11:00:00Z 2015-08-31T04:07:21Z antiquity Artifical terminator, estimated %T~=85 false true _41_ 0 745 41 In stock false Bidirectional, with the reverse estimated to be less effective than the forward. Has a polyA tail of 6 residues. true Haiyao Huang annotation1898412 1 B1002 range1898412 1 1 34 annotation1898414 1 Poly A tail range1898414 1 25 31 annotation1898415 1 Poly A tail range1898415 1 4 9 annotation1898413 1 stem loop range1898413 1 10 25 BBa_J61104 1 BBa_J61104 Ribosome Binding Site Family Member 2007-04-23T11:00:00Z 2015-08-31T02:03:00Z N/A {{JCA_Arkin_RBSFamily}} false false _95_ 0 483 95 In stock false N/A false John Anderson BBa_J61100 1 BBa_J61100 Ribosome Binding Site Family Member 2007-01-28T12:00:00Z 2015-08-31T02:03:00Z N/A {{JCA_Arkin_RBSFamily}} false true _95_ 0 483 95 In stock false N/A true John Anderson BBa_K1709006 1 BBa_K1709006 RBS-LuxI-His-RBS-LuxR-E-Term-Plux 2015-09-17T11:00:00Z 2015-09-18T11:29:08Z The Lux operon originates from V. Fischeri. Autoinducer synthetase for acyl-homoserine lactones (AHL): LuxI synthesizes AHL (3OC6HSL). Two molecules of AHL form a complex with two molecules of the LuxR protein. This complex then binds to a palyndromic site on the lux promoter, increasing its transcription rate. LuxI, LuxR and the right lux promoter are all derived from V. fischeri. In absence of AHL, the right Lux promotor only gives weak constitutive expression of downstream genes. Any gene you would like to be controlled by AHL and thus cell density can be cloned after this complex. false false _2129_ 25389 25389 9 false For the ease of cloning, the sequence was devided in multiple gBlocks. Therefor, there is a mistake in the composite part sequence since the scar is only partly present. false Astrid Deryckere component2473336 1 BBa_K1709004 component2473331 1 BBa_J61100 component2473341 1 BBa_B1002 component2473330 1 BBa_K1709001 component2473343 1 BBa_R0062 annotation2473341 1 BBa_B1002 range2473341 1 1463 1496 annotation2473331 1 BBa_J61100 range2473331 1 636 647 annotation2473330 1 BBa_K1709001 range2473330 1 1 627 annotation2473343 1 BBa_R0062 range2473343 1 1505 1559 annotation2473336 1 BBa_K1709004 range2473336 1 654 1454 BBa_K1709000 1 LuxI-His LuxI-His 2015-09-07T11:00:00Z 2015-09-18T04:12:52Z Sequence is originating from V. fischeri. Here, the sequence from BBa_C0061 was used and optimized. Autoinducer synthetase for acyl-homoserine lactones (AHL): LuxI synthesizes AHL (3OC6HSL). Two molecules of AHL form a complex with two molecules of the LuxR protein. This complex then binds to a palyndromic site on the lux promoter, increasing its transcription rate. LuxI, LuxR and the right lux promoter are all derived from V. fischeri. In absence of AHL, the right lux promotor only gives weak constitutive expression of downstream genes. The LuxI gene is fused to a His-tag facilitating gene expression measurements. false false _2129_ 25389 25389 9 true Biobrick BBa_C0061 still contained a Barcode sequence which was deleted. For our own use, 5 bp were exchanged to create unique restriction sites and to optimize DNA folding. false Astrid Deryckere annotation2446990 1 LuxI Coding Region range2446990 1 1 579 annotation2446989 1 ATG Start Codon range2446989 1 1 3 annotation2446992 1 Ochre Stop Codon range2446992 1 607 609 annotation2446991 1 Polyhistidine-tag range2446991 1 583 606 BBa_K1709001 1 BBa_K1709001 LuxI-His 2015-09-07T11:00:00Z 2015-09-26T09:17:10Z Sequence is originating from V. fischeri. Here, the sequence from BBa_C0061 was used and optimized. Autoinducer synthetase for acyl-homoserine lactones (AHL): LuxI synthesizes AHL (3OC6HSL). Two molecules of AHL form a complex with two molecules of the LuxR protein. This complex then binds to a palyndromic site on the lux promoter, increasing its transcription rate. LuxI, LuxR and the right lux promoter are all derived from V. fischeri. In absence of AHL, the right lux promotor only gives weak constitutive expression of downstream genes. The LuxI gene is fused to a His-tag facilitating gene expression measurements. false false _2129_ 25069 25389 9 true Biobrick BBa_C0061 still contained a Barcode sequence which was deleted. Also, a Ribosome Binding Site was added. For our own use, 5 bp were exchanged to create unique restriction sites and to optimize DNA folding. false Astrid Deryckere component2473568 1 BBa_K1709000 component2473563 1 BBa_J61104 annotation2473568 1 BBa_K1709000 range2473568 1 19 627 annotation2473563 1 BBa_J61104 range2473563 1 1 12 BBa_K1709004 1 BBa_K1709004 LuxR-E 2015-09-17T11:00:00Z 2015-09-18T11:21:02Z Sequence is originating from V. fischeri. Here, the sequence from BBa_I0462 was used and optimized. Encodes a transcription activator for the right handed Lux promotor. Two molecules of acyl-homoserine lactones (AHL) form a complex with two molecules of the LuxR protein. This complex then binds to a palyndromic site on the lux promoter, increasing its transcription rate. LuxI, LuxR and the right lux promoter are all derived from V. fischeri. false false _2129_ 25389 25389 9 false Biobrick BBa_C0061 still contained a Barcode sequence which was deleted. For our own use, 9 bp were exchanged to create unique restriction sites and to optimize DNA folding. false Astrid Deryckere annotation2470849 1 Ochre Stop Codon range2470849 1 799 801 annotation2470866 1 E-tag range2470866 1 753 801 annotation2470868 1 LuxR range2470868 1 1 750 annotation2470847 1 ATG Start Codon range2470847 1 1 3 BBa_B1002_sequence 1 cgcaaaaaaccccgcttcggcggggttttttcgc BBa_R0062_sequence 1 acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa BBa_J61104_sequence 1 aaagaagggaca BBa_J61100_sequence 1 aaagaggggaca BBa_K1709006_sequence 1 aaagaagggacatactagatgactataatgataaaaaaatcggattttttggcaattccatcggaagagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactcaaatgcagaatatatttatgcttgtgatgatactgaaaatgtaagtggatgctggcgtttattacctacaacaggtgattatatgctgaaaagtgtttttcctgaattgcttggtcaacagagtgctcccaaagatcctaatatagtcgaattaagtcgttttgctgtaggtaaaaatagctcaaagataaataactctgctagtgaaattacaatgaaactatttgaagctatatataaacacgctgttagtcaaggtattacagaatatgtaacagtaacatcaacagcaatagagcgatttttaaagcgtattaaagttccttgtcatcgtattggagacaaagaaattcatgtattaggtgatactaaatcggttgtattatccatgcccatcaatgaacagtttaaaaaagcagtcttaaattcacaccatcaccatcaccatgccgcataatactagagaaagaggggacatactagatgaaaaacataaatgccgacgacacatacagaataatcaacaaaatcaaagcttgtagaagcaataatgatatcaatcaatgcttgtctgatatgactaaaatggtccattgcgaatattatttactcgcgatcatttatccacactctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattcaggtgcgccggtgccgtatccggatccgctggaaccgcgtgccgcataatactagagcgcaaaaaaccccgcttcggcggggttttttcgctactagagacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa BBa_K1709001_sequence 1 aaagaagggacatactagatgactataatgataaaaaaatcggattttttggcaattccatcggaagagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactcaaatgcagaatatatttatgcttgtgatgatactgaaaatgtaagtggatgctggcgtttattacctacaacaggtgattatatgctgaaaagtgtttttcctgaattgcttggtcaacagagtgctcccaaagatcctaatatagtcgaattaagtcgttttgctgtaggtaaaaatagctcaaagataaataactctgctagtgaaattacaatgaaactatttgaagctatatataaacacgctgttagtcaaggtattacagaatatgtaacagtaacatcaacagcaatagagcgatttttaaagcgtattaaagttccttgtcatcgtattggagacaaagaaattcatgtattaggtgatactaaatcggttgtattatccatgcccatcaatgaacagtttaaaaaagcagtcttaaattcacaccatcaccatcaccatgccgcataa BBa_K1709000_sequence 1 atgactataatgataaaaaaatcggattttttggcaattccatcggaagagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactcaaatgcagaatatatttatgcttgtgatgatactgaaaatgtaagtggatgctggcgtttattacctacaacaggtgattatatgctgaaaagtgtttttcctgaattgcttggtcaacagagtgctcccaaagatcctaatatagtcgaattaagtcgttttgctgtaggtaaaaatagctcaaagataaataactctgctagtgaaattacaatgaaactatttgaagctatatataaacacgctgttagtcaaggtattacagaatatgtaacagtaacatcaacagcaatagagcgatttttaaagcgtattaaagttccttgtcatcgtattggagacaaagaaattcatgtattaggtgatactaaatcggttgtattatccatgcccatcaatgaacagtttaaaaaagcagtcttaaattcacaccatcaccatcaccatgccgcataa BBa_K1709004_sequence 1 atgaaaaacataaatgccgacgacacatacagaataatcaacaaaatcaaagcttgtagaagcaataatgatatcaatcaatgcttgtctgatatgactaaaatggtccattgcgaatattatttactcgcgatcatttatccacactctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattcaggtgcgccggtgccgtatccggatccgctggaaccgcgtgccgcataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z