BBa_K1711001 1 BBa_K1711001 yeVenus-TheoA; coding sequence for enhanced yellow fluorescent protein and theophylline-sensative ap 2015-09-17T11:00:00Z 2015-09-19T03:47:39Z yeVenus is a modified yellow fluorescent protein, originating from the genome of A. victoria. The theophylline-repsonsive aptamer sequence originates from the genome of S. cerevisiae. Coding sequence for yellow fluorescence protein was given to us by Klavins lab at University of Washington. The aptazyme sequnce was given to us by the Smolke lab at Stanford.[1] [1]Townshend B, Kennedy AB, Xiang JS, Smolke CD. High-throughput cellular RNA device engineering. Nature Methods, Jun 2015. doi:10.1038/nmeth.3486 The part contains the coding sequence for yeast enhanced yellow fluorescent protein (yeVenus), linked to it is a gene for a theophylline sensitive riboswitch aptazyme. The aptazyme portion of the transcript self-cleaves in the absence of theophylline and no YFP should be produced. The theophylline bound state stabilizes the transcript, which translates to the protein and fluorescence should be observed. false false _2131_ 23387 23387 9 false We had to choose a linker sequence between the Venus and the aptazyme that would be free of secondary structure as a RNA transcript. false Anastasia Nicolov, Tom Duan, Justin Jenkins annotation2476135 1 6xGSB Linker range2476135 1 721 756 annotation2476136 1 Theophylline Aptamer AAAGA range2476136 1 757 860 annotation2476134 1 yeVenus range2476134 1 1 720 BBa_K1711001_sequence 1 atgtctaaaggtgaagaattattcactggtgttgtcccaattttggttgaattagatggtgatgttaatggtcacaaattttctgtctccggtgaaggtgaaggtgatgctacttacggtaaattgaccttaaaattgatttgtactactggtaaattgccagttccatggccaaccttagtcactactttaggttatggtttgcaatgttttgctagatacccagatcatatgaaacaacatgactttttcaagtctgccatgccagaaggttatgttcaagaaagaactatttttttcaaagatgacggtaactacaagaccagagctgaagtcaagtttgaaggtgataccttagttaatagaatcgaattaaaaggtattgattttaaagaagatggtaacattttaggtcacaaattggaatacaactataactctcacaatgtttacatcactgctgacaaacaaaagaatggtatcaaagctaacttcaaaattagacacaacattgaagatggtggtgttcaattagctgaccattatcaacaaaatactccaattggtgatggtccagtcttgttaccagacaaccattacttatcctatcaatctgccttatccaaagatccaaacgaaaagagagaccacatggtcttgttagaatttgttactgctgctggtattacccatggtattgatgaattgtacaaatgatgaggaagtggtagtggtagtggaagcggtagtggcagtaaacaaacaaagctgtcaccggaataccagcatcgtcttgatgcccttggaagtccggtctgatgagtccaaagaggacgaaacagcaaaaagaaaaataaaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z