BBa_K1716001 1 BBa_K1716001 GP35 recombinase optimized for expression in B. subtilis 2015-09-15T11:00:00Z 2015-09-16T02:18:36Z Bacillus subtilis phage SPP1 Recombination-mediated genetic engineering (recombineering) utlises homologous recombination to facilitate genetic modifications at any desired target by flanking the mutated sequence with homologous regions. Multiplex Automated Genome Engineering (MAGE) is a method for rapid and efficient targeted programming and evolution of cells through cyclical recombineering using multiple single-stranded DNA oligonucleotides (oligos). The MAGE protocol utilises the λ Red recombination system in combination with an (temporary) inactivation of the mismatch repair system and consists of 7 steps that can be done with standard laboratory equipment (Wang, 2009). As MAGE utilises oligos, only the Beta protein of the λ Red system is required. This BioBrick encodes the coding sequence for a recombinase homologous to lambda beta. It originates from B. subtilis phage SPP1. It is based on Sun et. al. findings that GP35 had higher recombining frequencies than lambda beta in B. subtilis, when electroplated with a long (>1,000 nucleotide) ssDNA generated by PCR. We tested it with oligos (90-mers) and saw lower recombineering frequencies than lambda beta in B. subtitles (please see Results). false false _2136_ 25211 25211 9 false CDS was obtained from NC_004166.2. The stop codon (TAG) was replaced by two TAA stop codons. false Pernille Neve Myers BBa_K1716001_sequence 1 atggcaactaaaaaacaagaggaattaaaaaacgcactagcacaacaaaacggagccgttccgcaaacaccagtcaagccgcaggataaagtaaagggctatctcgaaagaatgatgccagctattaaagatgtgttgcctaagcatttagacgctgatcgactttcccgcatcgcaatgaacgtcattaggactaacccgaaacttctggaatgtgatacggcatcactcatgggggctgtgctggagtcagctaaattaggagtggagccgggacttttgggacaagcgtatattttgccgtacacgaattacaaaaagaaaacggttgaagctcagttcattcttggttataagggcctccttgatctcgtgagacgctctggacacgtgagcacaatcagcgctcaaactgtttacaaaaacgacacattcgaatatgaatatgggttagatgacaagcttgttcacagacccgcaccattcggaacagacagaggggagccagttggatactacgctgtagcgaaaatgaaggatggcggatataacttccttgtcatgagtaaacaggatgtcgagaaacaccgggacgccttttccaagtctaaaaacagagagggagtagtgtatggcccatgggctgaccacttcgacgcaatggcgaaaaagacagtcttgcgccagcttatcaactatttacctatcagtgttgagcaattatcaggagtagcggcagacgaacggacaggatcagaacttcataaccaatttgcggatgacgacaacattattaacgtcgatatcaatacaggtgaaatcattgaccatcaagaaaaattaggaggggaaacaaatgaataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z