BBa_K1718002 1 BBa_K1718002 Genetic Switch for Bxb1 invertase 2015-09-12T11:00:00Z 2015-09-15T02:08:17Z Sequences are based on the Endy experiments. This part consists of a strong Anderson promoter and a terminator flanked by attB and attP, the recognition sites for BxbI. In its off position, the terminator prevents expression of the downstream part. If the BxbI invertase is expressed, it will recognize the attB and attP sites and invert the DNA; thus, flipping the terminator so polymerase can pass through the gate. The Bxb1 invertase flips DNA using the attB and attP sites. There is a Bxb1 excisionase that can flip the DNA back. false false _2138_ 0 22016 22016 9 It's complicated false The design consists of a terminator to stop transcription from the strong constitutive promoter. false Daren Kraft and Josephina Hendrix BBa_K1718002_sequence 1 aaaaaatttatttgctttcgcatctttttgtacctataatgtgtggaaagcttagctagctcggccggcttgtcgacgacggcggtctccgtcgtcaggatcatccgggcccggcttatcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtccacgacgctatacccaaaagaaagggtttgtaccgtacaccactgagaccgcggtggttgaccagacaaaccacgaagctgtcaccggatgtg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z