BBa_K1720002 1 BBa_K1720002 Hypoxia-induced promotor 2015-08-24T11:00:00Z 2015-09-18T07:26:50Z We find the information of Human guanylate cyclase??1,soluble, alpha 3 unit here：http://www.ncbi.nlm.nih.gov/gene/2982 This is a part used for coding soluble human guanylate cyclase subunit:Alpha 3.Alpha 3 unit interacts with a beta subunit to form the guanylate cyclase enzyme. Soluble guanylate cyclases(sGC) are heterodimeric proteins that catalyze the conversion of GTP to 3',5'-cyclic GMP and pyrophosphate. It is important for smooth muscle relaxation in the cardiovascular system. sGC contains an HNOX domain, which serves as a receptor for ligands such as nitric oxide, oxygen and nitrovasodilator drugs.There are several different isoforms of sGC subunit ,but the cardiovascular system abundant with alpha 3 unit and beta 3 unit. This part with a GFP reporter was then transfected into HEK293 cells by lentiviral Vector and in vivo green fluorescence signal was observed under fluorescence microscope, it meant that this part was transfected into HEK293 cells successfully.Then we used qRT-PCR to observe transcriptional level of alpha 3 unit.Finally we detected the cGMP concentration with Elisa Kit. And the results are as follow: false false _2140_ 25248 25248 9 false This part do not have promoter because the promoter we used in our project is EF1A which consists the restriction sites.So before using this part please add a promoter. false Yuanbin Cui, Yaran Zhao BBa_K1720002_sequence 1 cgatgtacgggccagatatacgcgttgacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtcgcctatacgtgggttcccgcacgtacgcttcgagtcgacagcggagacagggtatataagcagagctctctggctaactagagaacccactgcttactggcttatcgaaatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z