BBa_K1720003 1 BBa_K1720003 Human phosphodiesterase 5A gene silencing device NO.1 2015-08-26T11:00:00Z 2015-09-18T07:29:39Z We designed the shRNA according to the homology segment sequence of PDE5A from NCBI This device is uesd for silencing the human phosphodiesterase 5A (PDE5A) gene.A U6 promoter driving a designed, synthetic shRNA-like miRNA followed by the terminator. PDE5A is a cGMP-binding, cGMP-specific phosphodiesterase, a member of the cyclic nucleotide phosphodiesterase family. This phosphodiesterase specifically hydrolyzes cGMP to 5'-GMP. It is involved in the regulation of intracellular concentrations of cyclic nucleotides and is important for smooth muscle relaxation in the cardiovascular system. We designed 3 silencing device and test their function at the same time.Here is the another two device :BBa_K1720004,BBaK172005 This device with a GFP reporter was then transfected into HEK293 cells by lentiviral vector.Once we silence the PDE5A gene the level of cGMP will be up regulated as a result. The positive control was HEK293 cells that treat with Sodium Nitroprusside ,a NO donator that activate sGC and up regulate the level of cGMP. A negative control was made by transfecting an empty vector that does not contain sGC subunit. We used Elisa to detect cGMP level. The results are as follow: false false _2140_ 25248 25248 9 false 1. Kukreja RC, Salloum FN, Das A: Cyclic Guanosine Monophosphate Signaling and Phosphodiesterase-5 Inhibitors in Cardioprotection. Journal Of the American College Of Cardiology 2012, 59(22):1921-1927. 2. Li L, Haider HK, Wang L, Lu G, Ashraf M: Adenoviral short hairpin RNA therapy targeting phosphodiesterase 5a relieves cardiac remodeling and dysfunction following myocardial infarction. American Journal Of Physiology-Heart And Circulatory Physiology 2012, 302(10):H2112-H2121. 3. Unwalla HJ, Li HT, Bahner I, Li MJ, Kohn D, Rossi JJ: Novel Pol II fusion promoter directs human immunodeficiency virus type 1-inducible coexpression of a short hairpin RNA and protein. Journal of virology 2006, 80(4):1863-1873. false Ying Guan, Yuanbin Cui BBa_K1720003_sequence 1 gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattggaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccggttaagcctttcaaccgaaatgctcgagcatttcggttgaaaggcttaattttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z