BBa_K1722001 1 shTERT shTERT is a cancer cell specific promoter with high efficiency. 2015-08-27T11:00:00Z 2015-09-01T06:24:21Z The telomerase reverse transcriptase promoter can be found in human cancer cells. In our experiment, we got the part from Shenzhen second people's hospital. Additionally, we did our system's function verification in Shenzhen second people's hospital. Telomerase reverse transcriptase??(abbreviated to??TERT, or??hTERT??in humans) is a catalytic subunit of the??enzyme??telomerase, which, together with the??telomerase RNA component??(TERC), comprises the most important unit of the telomerase complex. The telomerase is a ribonucleoprotein enzyme to which multiple functions have been attributed, the most important of these is the maintenance of the telomere which is related with cellular immortalization and cancer. 85% of human tumors have telomerase activity, that in normal cells goes undetected. These characteristics make the telomerase an attractive target for chemotherapy. TERT??promoter??mutations were highly frequent in glioblastoma (83.9%), urothelial carcinoma (64.5%), oligodendroglioma (70.0%), medulloblastoma (33.3%) and hepatocellular carcinoma (31.4%). C228T and C250T were the most common mutations. In urothelial carcinoma, several novel rare mutations were identified. TERT??promoter??mutations were absent in gastrointestinal stromal tumour (GIST), thymic epithelial tumours, gastrointestinal leiomyoma, gastric schwannoma, cholangiocarcinoma, gastric and pancreatic cancer. TERT??promoter??mutations highly correlated with upregulated TERT mRNA expression and??telomerase??activity in adult gliomas. These mutations differentially enhanced the transcriptional activity of the TERT core??promoter.TERT??promoter??mutations are frequent in multiple tumour types and have similar distributions in Chinese cancer patients. The functional significance of these mutations reflect the importance to telomere maintenance and hence tumourigenesis, making them potential therapeutic targets. More??importantly , we mutate the normal TERTp into a new TERTp with high-efficency of the promotion so as to make our system work??efficiently. In the experiment, we change 4 base of the TERTp gene. Eventually, The telomerase reverse transcriptase promoter can specifically promotes with the identification of telomerase reverse transcriptase, which means it can only promote in cancer cells.In our system, we use TERTp to promote only in cancer cells. Together with bladder-specific hUPII promoter we can achieve the precision of system???s work in bladder cancer cells.??In our experiment, we constructed three and two plasmids before and after two times to verify the function using high-efficency TERTp.The TERTp can be used to promote in cancer cells. Similar to our system, alike synthesizing gene circuits are also expected to be one of the promising approaches to the treatment to other cancer. false false _2142_ 26634 26635 9 false We designed the following primers and amplified hTERT promoter from the vector psi-Check2: Sequence(up)CCGGAATTCGGCACCTCCCTCGGGTTAG Sequence(down)TGCACTGCAGACTAGTCGCGTGGGTGGCCG. By incorporating these primers into hTERT promoter, the promoter is flanked by the iGEM prefix and suffix after amplification. false Fang Shu BBa_K1722001_sequence 1 ggcccctccctcgggttaccccacagcctaggccgattcgacctctctccgctggggccctcgctggcgtccctgcaccctgggagcgcgagcggcgcgcgggcggggaagcgcggcccagacccccgggtccgcccggagcagctgcgctgtcggggccaggccgggctcccagtggattcgcgggcacagacgcccaggaccgcgctccccacgtggcggagggactggggacccgggcacccgtcctgccccttcaccttccagctccgcctcctccgcgcggaccccgccccgtcccgaccccttccgggtttccggcccagccccttccgggccctcccagcccctccccttcctttccgcggccccgccctctcctcgcggcgcgagtttcaggcagcgctgcgtcctgctgcgcacgtgggaagccctggccccggccacccccgcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z