BBa_K1722003 1 AckRS AckRS can produce a aminoacyl tRNA synthetase. 2015-08-26T11:00:00Z 2015-09-07T08:59:02Z We achieved this part from Shenzhen Second People's Hospital, which is Shenzhen University First Hospital. They were doing reseach on unnatural amino acid orthogonal system and fortunately, they agree to provide us the gene. Ack is a kind of unnatural amino acid(UAA) that is close structural analog of Lysine, a canonocal amino acid. In the orthogonal system of the project of 2015 SZU-iGEM, the construction of our UAA orthogonal system rely on an orthogonal pair of tRNA(CUA) and an AckRS charging the tRNA with Ack. tRNA(CUA) has an anticodon CUA, which can pair with UAG, the amber mutated stop codon, perfectly. With the help of AckRS, the unnatural amino acid Ack can be incorporated into proteins. aaRS functioning in the form of polycomplex in living cells. Research on Structural Biology and Bioinformatics shows that aaRS can combine with other proteins, forming highly organized complex, to be involved in many vital physiological processes. In the last decade, methods for the translational incorporation of UAAs using orthogonal aaRS-tRNA(CUA) pairs were developed. With modified aaRS which can specifically recognise a type of UAA, the UAA can be site-specifically incorporated to produce a protein with new structure and function or to expand the genetic code. The wild-type pyrrolysyl-tRNA synthatase(PylRS) from Methanosarcina mazei readily accepts a number of lysine derivatives as substrates. This enzyme can further be engineered by mutagenesis to utilize a range of UAAs and the AckRS that we used in our project is one of them. false false _2142_ 20403 26634 9 false The AckRS that we achieved from Shenzhen Second People's Hospital was carried by psi-Check2, which was Amp resistence. After sequencing, we found AckRS has two EcoR1 enzyme cutting site, which are the same as the site in the flank of pSB1C3. So we mutate one of the base pairs on each of the two sites. The plasmid with AckRS that we submitted is EcoR1 free. false Hao Wang BBa_K1722003_sequence 1 atggataaaaaaccgctggatgtgctgattagcgcgaccggcctgtggatgagccgtaccggcaccctgcataaaatcaaacatcatgaagtgagccgcagcaaaatctatattgaaatggcgtgcggcgatcatctggtggtgaacaacagccgtagctgccgtaccgcgcgtgcgtttcgtcatcataaataccgcaaaacctgcaaacgttgccgtgtgagcggtgaagatatcaacaactttctgacccgtagcaccgaaagcaaaaacagcgtgaaagtgcgtgtggtgagcgcgccgaaagtgaaaaaagcgatgccgaaaagcgtgagccgtgcgccgaaaccgctggaaaatagcgtgagcgcgaaagcgagcaccaacaccagccgtagcgttccgagcccggcgaaaagcaccccgaacagcagcgttccggcgtctgcgccggcaccgagcctgacccgcagccagctggatcgtgtggaagcgctgctgtctccggaagataaaattagcctgaacatggcgaaaccgtttcgtgaactggaaccggaactggtgacccgtcgtaaaaacgattttcagcgcctgtataccaacgatcgtgaagattatctgggcaaactggaacgtgatatcaccaaattttttgtggatcgcggctttctggaaattaaaagcccgattctgattccggcggaatatgtggaacgtatgggcattaacaacgacaccgaactgagcaaacaaattttccgcgtggataaaaacctgtgcctgcgtccgatgatggccccgaccatttttaactatgctcgtaaactggatcgtattctgccgggtccgatcaaaatttttgaagtgggcccgtgctatcgcaaagaaagcgatggcaaagaacacctggaagtattcaccatggttaacttttttcaaatgggcagcggctgcacccgtgaaaacctggaagcgctgatcaaagtattcctggattatctggaaatcgacttcgaaattgtgggcgatagctgcatggtgtatggcgataccctggatattatgcatggcgatctggaactgagcagcgcggtggtgggtccggttagcctggatcgtgaatggggcattgataaaccgtggattggcgcgggttttggcctggaacgtctgctgaaagtgatgcatggcttcaaaaacattaaacgtgcgagccgtagcgaaagctactataacggcattagcacgaacctgtaactcgag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z