BBa_K1722004 1 aa-tRNA This is a kind of aminoacyl-tRNA(aa-tRNA). 2015-08-25T11:00:00Z 2015-09-07T08:29:17Z It came from barchaebacteria. This is a kind of aminoacyl-tRNA, which has a diffeent structure compared with classic tRNA.The tRNA can only carry a specific amino acid, and is non natural amino acids.It has special anticodons(CUA),which can identify the termination codon(UAG), and then adds the unnatural amino acid carried own into the polypeptide chain to.So that the position of the termination codon corresponds to the insertion of an unnatural amino acid, which allows the protein to continue to be translated. The aminoacyl-tRNA came from barchaebacteria,and it is generally applied to unnatural amino acid orthogonal system. In our project, the aminoacyl-tRNA was selected by directed evolution. false false _2142_ 20403 20403 9 false Because itonly has 72 bases, and the traditional PCR method is not applicable for this,we get his by gene synthesising. false Yongyi Wang BBa_K1722004_sequence 1 ggaaacctgatcatgtagatcgaatggactctaaatccgttcagccgggttagattcccggggtttccgcca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z