BBa_K1722006 1 SV40(en) SV40（with Enhancer） is a widely used strong promoter. 2015-08-31T11:00:00Z 2015-09-07T06:31:40Z SV40 promoter with enhancer was achieved from Shenzhen Second People's Hospital. SV40 is an abbreviation for Simian Virus 40, a polyomavirus that is found in both monkeys and humans. SV40 promoter, which is one of the earliest virus promoter being found by biologists, can improve the gene expression level of many host cells. Similar to 35S promoter, SV40 has a relatively small genetic structure and high expression driving ability. As a strong promoter being widely used in genetic engineering, SV40 has a close affinity with RNA polymerase and can direct the massive synthesizing of mRNA. In our project, we construct SV40 and Renilla luciferase(Rlu) in the same plasmid. By detecting the expression of Rlu, we are able to tell the working efficiency of our system. false false _2142_ 20403 26634 9 false We designed the following primers and amplified SV40 promoter from the vector psi-Check2: By incorporating these primers into hUPII promoter, the promoter is flanked by the iGEM prefix and suffix after amplification. false Zeyu Miao BBa_K1722006_sequence 1 gcgcagcaccatggcctgaaataacctctgaaagaggaacttggttaggtaccttctgaggcggaaagaaccagctgtggaatgtgtgtcagttagggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctcggcctctgagctattccagaagtagtgaggaggcttttttggaggcctaggcttttgcaaaaagctt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z