BBa_K1722007 1 UPll+AckRS hUPll+AckRS Composite 2015-09-01T11:00:00Z 2015-09-07T08:59:42Z We achieved both hUPll promoter and AckRS from Shenzhen Second People's Hospital. hUPll is a bladder tissue-specific promoter being found in human urothelium. Uroplakin II (UPII) has been characterized as a bladder tissue-specific protein[1] and the expression of uroplakin II was found to be limited to bladder-derived cells.[2,3] Other members of uroplakins, including uroplakinla(UPla), uroplakinlb(UPlb), and uroplakinlll(UPlll), have also been characterized. Therefore, the promoters that direct the expression of the uroplakins may be useful in constructing tissue-specific vectors for bladder cancer gene therapy. Research shows that most of thecis elements that confer the bladder-specificity and differentiation-dependent expression of the human UPll gene reside in the 2542-bp sequence, and TNF driven by the human UPll(hUPll) promoter is effective in the specific inhibition of bladder cancer growth both in vivo and in vitro. Ack is a kind of unnatural amino acid(UAA) that is close structural analog of Lysine, a canonocal amino acid. In the orthogonal system of the project of 2015 SZU-iGEM, the construction of our UAA orthogonal system rely on an orthogonal pair of tRNA(CUA) and an AckRS charging the tRNA with Ack. tRNA(CUA) has an anticodon CUA, which can pair with UAG, the amber mutated stop codon, perfectly. With the help of AckRS, the unnatural amino acid Ack can be incorporated into proteins. aaRS functioning in the form of polycomplex in living cells. Research on Structural Biology and Bioinformatics shows that aaRS can combine with other proteins, forming highly organized complex, to be involved in many vital physiological processes. In the last decade, methods for the translational incorporation of UAAs using orthogonal aaRS-tRNA(CUA) pairs were developed. With modified aaRS which can specifically recognise a type of UAA, the UAA can be site-specifically incorporated to produce a protein with new structure and function or to expand the genetic code. The wild-type pyrrolysyl-tRNA synthatase(PylRS) from Methanosarcina mazei readily accepts a number of lysine derivatives as substrates. This enzyme can further be engineered by mutagenesis to utilize a range of UAAs and the AckRS that we used in our project is one of them. We constructed hUPll and AckRS in this plasmid to initiate the expression of AckRS inside bladder cells. When both the hUPll and hTERT promoters are activated in bladder cancer cells, the whole orthogonal system that we have constructed can work efficiently. false false _2142_ 20403 26634 9 false The AckRS gene that is achieved from Shenzhen Second People's Hospital has two EcoR1 restriction enzyme cutting sites in its sequence. We mutated them and designed primers to amplified both hUPll and AckRS from psi-Check2 vector. Then 3A Assembly was used to construct these two gene in pSB1C3. false Hui Ai component2442693 1 BBa_K1722003 component2442692 1 BBa_K1722000 annotation2442692 1 BBa_K1722000 range2442692 1 1 355 annotation2442693 1 BBa_K1722003 range2442693 1 362 1627 BBa_K1722000 1 hUPll hUPll is a bladder tissue-specific promoter . 2015-08-25T11:00:00Z 2015-09-09T02:02:31Z hUPII gene was achieved from Shenzhen Second People's Hospital. We read a scientific treatise talking about targeted therapy of bladder cancer written by a doctor in Shenzhen Second People's Hospital and tried to seek cooperation with them. Fortunately, they agree to provide us hUPII with psi-Check2 as its vector. Uroplakin II (UPII) has been characterized as a bladder tissue-specific protein and the expression of uroplakin II was found to be limited to bladder-derived cells. 2015 SZU-iGEM use hUPII to drive the expression of the therapeutic genes(such as p21 and Bax) so that the gene is expressed only in bladder cells and systematic toxicity is minimized. We tested hUPII gene in HFC(Human Fiber Epithelial Cells)，5637，T24 and Hela cell lines and found it can confer preferential expression of genes in the bladder urothelium like HFC, which are normal bladder cells, 5637 and T24, which are bladder cancer cells. false false _2142_ 26634 26634 9 false We designed the following primers and amplified hUPII promoter from the vector psi-Check2: CCGGAATTCATCGGGTGATCAGTACTCC TGCACTGCAGACTAGTACTGAGCTGTGAGGT By incorporating these primers into hUPII promoter, the promoter is flanked by the iGEM prefix and suffix after amplification. false Yin Xiao BBa_K1722003 1 AckRS AckRS can produce a aminoacyl tRNA synthetase. 2015-08-26T11:00:00Z 2015-09-07T08:59:02Z We achieved this part from Shenzhen Second People's Hospital, which is Shenzhen University First Hospital. They were doing reseach on unnatural amino acid orthogonal system and fortunately, they agree to provide us the gene. Ack is a kind of unnatural amino acid(UAA) that is close structural analog of Lysine, a canonocal amino acid. In the orthogonal system of the project of 2015 SZU-iGEM, the construction of our UAA orthogonal system rely on an orthogonal pair of tRNA(CUA) and an AckRS charging the tRNA with Ack. tRNA(CUA) has an anticodon CUA, which can pair with UAG, the amber mutated stop codon, perfectly. With the help of AckRS, the unnatural amino acid Ack can be incorporated into proteins. aaRS functioning in the form of polycomplex in living cells. Research on Structural Biology and Bioinformatics shows that aaRS can combine with other proteins, forming highly organized complex, to be involved in many vital physiological processes. In the last decade, methods for the translational incorporation of UAAs using orthogonal aaRS-tRNA(CUA) pairs were developed. With modified aaRS which can specifically recognise a type of UAA, the UAA can be site-specifically incorporated to produce a protein with new structure and function or to expand the genetic code. The wild-type pyrrolysyl-tRNA synthatase(PylRS) from Methanosarcina mazei readily accepts a number of lysine derivatives as substrates. This enzyme can further be engineered by mutagenesis to utilize a range of UAAs and the AckRS that we used in our project is one of them. false false _2142_ 20403 26634 9 false The AckRS that we achieved from Shenzhen Second People's Hospital was carried by psi-Check2, which was Amp resistence. After sequencing, we found AckRS has two EcoR1 enzyme cutting site, which are the same as the site in the flank of pSB1C3. So we mutate one of the base pairs on each of the two sites. The plasmid with AckRS that we submitted is EcoR1 free. false Hao Wang BBa_K1722003_sequence 1 atggataaaaaaccgctggatgtgctgattagcgcgaccggcctgtggatgagccgtaccggcaccctgcataaaatcaaacatcatgaagtgagccgcagcaaaatctatattgaaatggcgtgcggcgatcatctggtggtgaacaacagccgtagctgccgtaccgcgcgtgcgtttcgtcatcataaataccgcaaaacctgcaaacgttgccgtgtgagcggtgaagatatcaacaactttctgacccgtagcaccgaaagcaaaaacagcgtgaaagtgcgtgtggtgagcgcgccgaaagtgaaaaaagcgatgccgaaaagcgtgagccgtgcgccgaaaccgctggaaaatagcgtgagcgcgaaagcgagcaccaacaccagccgtagcgttccgagcccggcgaaaagcaccccgaacagcagcgttccggcgtctgcgccggcaccgagcctgacccgcagccagctggatcgtgtggaagcgctgctgtctccggaagataaaattagcctgaacatggcgaaaccgtttcgtgaactggaaccggaactggtgacccgtcgtaaaaacgattttcagcgcctgtataccaacgatcgtgaagattatctgggcaaactggaacgtgatatcaccaaattttttgtggatcgcggctttctggaaattaaaagcccgattctgattccggcggaatatgtggaacgtatgggcattaacaacgacaccgaactgagcaaacaaattttccgcgtggataaaaacctgtgcctgcgtccgatgatggccccgaccatttttaactatgctcgtaaactggatcgtattctgccgggtccgatcaaaatttttgaagtgggcccgtgctatcgcaaagaaagcgatggcaaagaacacctggaagtattcaccatggttaacttttttcaaatgggcagcggctgcacccgtgaaaacctggaagcgctgatcaaagtattcctggattatctggaaatcgacttcgaaattgtgggcgatagctgcatggtgtatggcgataccctggatattatgcatggcgatctggaactgagcagcgcggtggtgggtccggttagcctggatcgtgaatggggcattgataaaccgtggattggcgcgggttttggcctggaacgtctgctgaaagtgatgcatggcttcaaaaacattaaacgtgcgagccgtagcgaaagctactataacggcattagcacgaacctgtaactcgag BBa_K1722000_sequence 1 catcgggggagcagtcctccaaggactggccagtctccagatgcccgtgcacacaggaacactgccttatgcacgggagtcccagaagaaggggtgatttctttccccaccttagttacaccatcaagacccagccagggcatcccccctcctggcctgagggccagctccccatcctgaaaaacctgtctgctctccccacccctttgaggctatagggcccaaggggcaggttggactggattcccctccagcccctcccacccccaggacaaaatcagccaccccaggggcagggcctcacttgcctcaggaaccccagcctgccagcacctattccacctcccagcccagc BBa_K1722007_sequence 1 catcgggggagcagtcctccaaggactggccagtctccagatgcccgtgcacacaggaacactgccttatgcacgggagtcccagaagaaggggtgatttctttccccaccttagttacaccatcaagacccagccagggcatcccccctcctggcctgagggccagctccccatcctgaaaaacctgtctgctctccccacccctttgaggctatagggcccaaggggcaggttggactggattcccctccagcccctcccacccccaggacaaaatcagccaccccaggggcagggcctcacttgcctcaggaaccccagcctgccagcacctattccacctcccagcccagctactagatggataaaaaaccgctggatgtgctgattagcgcgaccggcctgtggatgagccgtaccggcaccctgcataaaatcaaacatcatgaagtgagccgcagcaaaatctatattgaaatggcgtgcggcgatcatctggtggtgaacaacagccgtagctgccgtaccgcgcgtgcgtttcgtcatcataaataccgcaaaacctgcaaacgttgccgtgtgagcggtgaagatatcaacaactttctgacccgtagcaccgaaagcaaaaacagcgtgaaagtgcgtgtggtgagcgcgccgaaagtgaaaaaagcgatgccgaaaagcgtgagccgtgcgccgaaaccgctggaaaatagcgtgagcgcgaaagcgagcaccaacaccagccgtagcgttccgagcccggcgaaaagcaccccgaacagcagcgttccggcgtctgcgccggcaccgagcctgacccgcagccagctggatcgtgtggaagcgctgctgtctccggaagataaaattagcctgaacatggcgaaaccgtttcgtgaactggaaccggaactggtgacccgtcgtaaaaacgattttcagcgcctgtataccaacgatcgtgaagattatctgggcaaactggaacgtgatatcaccaaattttttgtggatcgcggctttctggaaattaaaagcccgattctgattccggcggaatatgtggaacgtatgggcattaacaacgacaccgaactgagcaaacaaattttccgcgtggataaaaacctgtgcctgcgtccgatgatggccccgaccatttttaactatgctcgtaaactggatcgtattctgccgggtccgatcaaaatttttgaagtgggcccgtgctatcgcaaagaaagcgatggcaaagaacacctggaagtattcaccatggttaacttttttcaaatgggcagcggctgcacccgtgaaaacctggaagcgctgatcaaagtattcctggattatctggaaatcgacttcgaaattgtgggcgatagctgcatggtgtatggcgataccctggatattatgcatggcgatctggaactgagcagcgcggtggtgggtccggttagcctggatcgtgaatggggcattgataaaccgtggattggcgcgggttttggcctggaacgtctgctgaaagtgatgcatggcttcaaaaacattaaacgtgcgagccgtagcgaaagctactataacggcattagcacgaacctgtaactcgag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z