BBa_K1722001 1 shTERT shTERT is a cancer cell specific promoter with high efficiency. 2015-08-27T11:00:00Z 2015-09-01T06:24:21Z The telomerase reverse transcriptase promoter can be found in human cancer cells. In our experiment, we got the part from Shenzhen second people's hospital. Additionally, we did our system's function verification in Shenzhen second people's hospital. Telomerase reverse transcriptase??(abbreviated to??TERT, or??hTERT??in humans) is a catalytic subunit of the??enzyme??telomerase, which, together with the??telomerase RNA component??(TERC), comprises the most important unit of the telomerase complex. The telomerase is a ribonucleoprotein enzyme to which multiple functions have been attributed, the most important of these is the maintenance of the telomere which is related with cellular immortalization and cancer. 85% of human tumors have telomerase activity, that in normal cells goes undetected. These characteristics make the telomerase an attractive target for chemotherapy. TERT??promoter??mutations were highly frequent in glioblastoma (83.9%), urothelial carcinoma (64.5%), oligodendroglioma (70.0%), medulloblastoma (33.3%) and hepatocellular carcinoma (31.4%). C228T and C250T were the most common mutations. In urothelial carcinoma, several novel rare mutations were identified. TERT??promoter??mutations were absent in gastrointestinal stromal tumour (GIST), thymic epithelial tumours, gastrointestinal leiomyoma, gastric schwannoma, cholangiocarcinoma, gastric and pancreatic cancer. TERT??promoter??mutations highly correlated with upregulated TERT mRNA expression and??telomerase??activity in adult gliomas. These mutations differentially enhanced the transcriptional activity of the TERT core??promoter.TERT??promoter??mutations are frequent in multiple tumour types and have similar distributions in Chinese cancer patients. The functional significance of these mutations reflect the importance to telomere maintenance and hence tumourigenesis, making them potential therapeutic targets. More??importantly , we mutate the normal TERTp into a new TERTp with high-efficency of the promotion so as to make our system work??efficiently. In the experiment, we change 4 base of the TERTp gene. Eventually, The telomerase reverse transcriptase promoter can specifically promotes with the identification of telomerase reverse transcriptase, which means it can only promote in cancer cells.In our system, we use TERTp to promote only in cancer cells. Together with bladder-specific hUPII promoter we can achieve the precision of system???s work in bladder cancer cells.??In our experiment, we constructed three and two plasmids before and after two times to verify the function using high-efficency TERTp.The TERTp can be used to promote in cancer cells. Similar to our system, alike synthesizing gene circuits are also expected to be one of the promising approaches to the treatment to other cancer. false false _2142_ 26634 26635 9 false We designed the following primers and amplified hTERT promoter from the vector psi-Check2: Sequence(up)CCGGAATTCGGCACCTCCCTCGGGTTAG Sequence(down)TGCACTGCAGACTAGTCGCGTGGGTGGCCG. By incorporating these primers into hTERT promoter, the promoter is flanked by the iGEM prefix and suffix after amplification. false Fang Shu BBa_K1722009 1 shTERT+GFP shTERT+GFP Composite 2015-09-01T11:00:00Z 2015-09-07T09:01:11Z This composite part is assembled using shTERT and GFP. shTERT promoter is achieved from Shenzhen Second People's Hospital and GFP is achieved from 2015 Distribution Kit. We constructed the two DNA sequence in pSB1C3, the required vector. hTERT, which is short for human telomerase reverse transcriptase, is a cancer-cell specific promoter. It can be activated inside cancer cells with no effect on normal cells. By mutating four base pairs of hTERT sequence, we achieved an improved promoter with higher promote efficiency named super hTERT(shTERT). As an important component of human telomerase, hTERT express only in tumor cells and other immortal cells which are telomerase positive. Only in tumor cells that can express TERT can the promoter being activated to realize targeted expression of effector gene. In this plasmid, we construct hTERT with Green Fluorescent Protein(GFP), which is a widely used reporter gene. When shTERT promoter is activated, GFP is produced and be oxidized to fluoresce. By inserting this plasmid into T24 and 5637, two lines of bladder cancer cells, we are able to acquire GFP. Green fluorescent light is detected using confocal laser scanning microscopy. This indicates that hTERT promoter is able to be activated inside bladder cancer cells. false false _2142_ 20403 26634 9 false The shTERT promoter that is achieved from Shenzhen Sencond People's Hospital is constructed in psi-Check2 vector. To assemble it with GFP and pSB1C3, we have to design primers with certain restriction enzyme cutting site and amplify it. Then assemble the three parts using 3A Assembly Method. false Huilin Xie component2442683 1 BBa_K1365020 component2442680 1 BBa_K1722001 annotation2442680 1 BBa_K1722001 range2442680 1 1 454 annotation2442683 1 BBa_K1365020 range2442683 1 461 1177 BBa_K1365020 1 BBa_K1365020 sfGFP(Bs) 2014-09-23T11:00:00Z 2015-05-08T01:10:07Z PCR on plasmid MG_sfgfp(Bs), used in the study 'Benchmarking Various Green Fluorescent Protein Variants in Bacillus subtilis, Streptococcus pneumoniae, and Lactococcus lactis for Live Cell Imaging', see references. Plasmid kindly provided by the Molecular Genetics group of the Rijksuniversiteit Groningen. Codes for the sfGFP protein, an optimized fluorescent reporter. Was originally optimized for Bacillus subtilis, but then showed high fluorescence in Lactococcus lactis. false false _1741_ 0 23000 9 In stock false Used primers: forward - 5'-GTTTCTTCGAATTCGCGGCCGCTTCTAGATGTCAAAAGGAGAAGAGCT-3' reverse - 5'-GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTACTTATAAAGCTCAT-3' to PCR sfGFP(Bs) from the plasmid and add the BioBrick prefix and suffix. false Sandra Mous annotation2420001 1 stop range2420001 1 715 717 annotation2420000 1 sfGFP(Bs) range2420000 1 1 717 annotation2419999 1 start range2419999 1 1 1 BBa_K1722009_sequence 1 ggcccctccctcgggttaccccacagcctaggccgattcgacctctctccgctggggccctcgctggcgtccctgcaccctgggagcgcgagcggcgcgcgggcggggaagcgcggcccagacccccgggtccgcccggagcagctgcgctgtcggggccaggccgggctcccagtggattcgcgggcacagacgcccaggaccgcgctccccacgtggcggagggactggggacccgggcacccgtcctgccccttcaccttccagctccgcctcctccgcgcggaccccgccccgtcccgaccccttccgggtttccggcccagccccttccgggccctcccagcccctccccttcctttccgcggccccgccctctcctcgcggcgcgagtttcaggcagcgctgcgtcctgctgcgcacgtgggaagccctggccccggccacccccgcgtactagatgtcaaaaggagaagagctgttcacaggtgttgtgccgattctcgttgagcttgacggagatgtaaacggacacaaattctctgttcgcggtgaaggtgaaggagatgcaacaaacggcaagctgacattgaagtttatttgcacaactggaaagctgccggttccttggccgacacttgtaacgacgctgacttacggcgttcaatgcttctctcgttatccagaccacatgaaacgccatgatttcttcaaatctgcaatgcctgaaggctacgttcaagagcgtacgatcagcttcaaagatgacggaacgtacaaaacaagagcagaagtgaagtttgaaggtgacacacttgtgaaccgcattgaattgaaaggcattgatttcaaagaagatggaaacatccttggacacaaacttgaatacaacttcaacagccacaacgtatacatcactgctgacaaacaaaaaaacggcatcaaagcaaacttcaaaatccgtcataacgtagaggacggttctgttcagcttgctgatcattatcagcaaaatacaccgatcggtgacggcccggttcttcttcctgataaccattatttatcaactcaaagcgtattatcaaaagacccaaatgaaaagcgtgaccacatggtgctgcttgaatttgtgacagctgctggtatcactcacggcatggatgagctttataagtaa BBa_K1365020_sequence 1 atgtcaaaaggagaagagctgttcacaggtgttgtgccgattctcgttgagcttgacggagatgtaaacggacacaaattctctgttcgcggtgaaggtgaaggagatgcaacaaacggcaagctgacattgaagtttatttgcacaactggaaagctgccggttccttggccgacacttgtaacgacgctgacttacggcgttcaatgcttctctcgttatccagaccacatgaaacgccatgatttcttcaaatctgcaatgcctgaaggctacgttcaagagcgtacgatcagcttcaaagatgacggaacgtacaaaacaagagcagaagtgaagtttgaaggtgacacacttgtgaaccgcattgaattgaaaggcattgatttcaaagaagatggaaacatccttggacacaaacttgaatacaacttcaacagccacaacgtatacatcactgctgacaaacaaaaaaacggcatcaaagcaaacttcaaaatccgtcataacgtagaggacggttctgttcagcttgctgatcattatcagcaaaatacaccgatcggtgacggcccggttcttcttcctgataaccattatttatcaactcaaagcgtattatcaaaagacccaaatgaaaagcgtgaccacatggtgctgcttgaatttgtgacagctgctggtatcactcacggcatggatgagctttataagtaa BBa_K1722001_sequence 1 ggcccctccctcgggttaccccacagcctaggccgattcgacctctctccgctggggccctcgctggcgtccctgcaccctgggagcgcgagcggcgcgcgggcggggaagcgcggcccagacccccgggtccgcccggagcagctgcgctgtcggggccaggccgggctcccagtggattcgcgggcacagacgcccaggaccgcgctccccacgtggcggagggactggggacccgggcacccgtcctgccccttcaccttccagctccgcctcctccgcgcggaccccgccccgtcccgaccccttccgggtttccggcccagccccttccgggccctcccagcccctccccttcctttccgcggccccgccctctcctcgcggcgcgagtttcaggcagcgctgcgtcctgctgcgcacgtgggaagccctggccccggccacccccgcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z