BBa_K1722004 1 aa-tRNA This is a kind of aminoacyl-tRNA(aa-tRNA). 2015-08-25T11:00:00Z 2015-09-07T08:29:17Z It came from barchaebacteria. This is a kind of aminoacyl-tRNA, which has a diffeent structure compared with classic tRNA.The tRNA can only carry a specific amino acid, and is non natural amino acids.It has special anticodons(CUA),which can identify the termination codon(UAG), and then adds the unnatural amino acid carried own into the polypeptide chain to.So that the position of the termination codon corresponds to the insertion of an unnatural amino acid, which allows the protein to continue to be translated. The aminoacyl-tRNA came from barchaebacteria,and it is generally applied to unnatural amino acid orthogonal system. In our project, the aminoacyl-tRNA was selected by directed evolution. false false _2142_ 20403 20403 9 false Because itonly has 72 bases, and the traditional PCR method is not applicable for this,we get his by gene synthesising. false Yongyi Wang BBa_K1722002 1 BBa_K1722002 hTERT is a tumor specific promoter. 2015-08-31T11:00:00Z 2015-09-07T08:15:36Z The telomerase reverse transcriptase promoter can be found in human cancer cells. In our experiment, we got the part from Shenzhen Second People's Hospital. Additionally, the verification of our system's function was also carried out in Shenzhen Second People's Hospital. hTERT is a tumor specific promoter which is short for human telomerase reverse transcriptase. The human telomerase enzyme complex consists of human telomerase reverse transcriptase(TERT), telomerase RNA(TR) and dyskerin(DKCI). This class of enzyme can catalyze the adding of (TTAGGG)n to the 3' end of telomeres to elongate the telomeres, thus prolonging cells' life. Researches show that the telomerase activity is based mostly on the expression level of TERT instead of that of TR and TEP. High telomerase activities are tested on most high proliferation cells such as tumor cells and stem cells. The core region of hTERT promoter lies on the 181bp sequence upstream of transcriptional start site, involving several binding sites for transcriptional factors, like sp1, cmyc, p53 and mad1. Researches show that hTERT promoters are activated in tumor cells that are telomerase positive while being inhibited in normal cells that are telomerase negative, which indicates that hTERT promoter may specifically target at tumor cells. Gu et al found the transcriptional activity of CMV promoter was almost 500 times higher than that of hTERT promoter in normal cells. However, the magnification shrinked to only 5-20 in tumor cells. So in this study, we choose hTERT as a promoter to specifically recognise cancer cells to express the downstream effector. We constructed hTERT and GFP in the same plasmid and inserted the plasmid into T24, a bladder cancer cell line, to test if hTERT can be activated inside the cell. Luckily, we saw green fluorescent light using confocal laser scanning microscopy. false false _2142_ 20403 26634 9 false We designed the following primers and amplified hTERT promoter from the vector psi-Check2:Up: CCGGAATTCGGCACCTCCCTCGGGTTAG Down: TGCACTGCAGACTAGTCGCGTGGGTGGCCG. By incorporating these primers into hTERT promoter, the promoter is flanked by the iGEM prefix and suffix after amplification. false Hao Wang BBa_K1722010 1 hTERT+tRNA hTERT+tRNA Composite 2015-09-01T11:00:00Z 2015-09-07T09:02:02Z Both hTERT promoter and tRNA are achieved from Shenzhen Second People's Hospital. Targeted therapy has become the fastest growing subject in research on cancer treatment. Telomerase, which serves as the tumor marker, is activated in most malignancy while it's negatively expressed in normal cells. Because of the high expression of human telomerase reverse transcriptase(hTERT) gene in telomerase positive cancer cells, researchers construct plasmids with hTERT promoter and effector gene to target at cancer cells and kill them. It has been proved that hTERT can regulate the activation and expression of telomerase in transcription level. Research shows that hTERT promoter is rich in GC but lack of TATA box or CAAT box. It's also methylated and deacetylated in different level. We construct hTERT promoter and tRNA in the same plasmid to produce tRNA. In the unnatural amino acid orthogonal system that we are constructing, hUPll promoter and hTERT promoter can recognise bladder specific RNA polymerase and tumor specific RNA polymerase, respectively. Only when the two promoters are activated simultanuously can both AckRS and tRNA be produced. In this way, Ack can be attached to tRNA that perfectly pair with the mRNA chain to express the protein. false false _2142_ 20403 26634 9 false Both hTERT promoter and tRNA are achieved from Shenzhen Second People's Hospital. We designed primers and amplified the gene sequences from psi-Check2 vector. Using 3A Assembly method, we constructed hTERT and tRNA in pSB1C3. false Hao Wang component2442688 1 BBa_K1722004 component2442687 1 BBa_K1722002 annotation2442688 1 BBa_K1722004 range2442688 1 463 534 annotation2442687 1 BBa_K1722002 range2442687 1 1 454 BBa_K1722002_sequence 1 ggcccctccctcgggttaccccacagcctaggccgattcgacctctctccgctggggccctcgctggcgtccctgcaccctgggagcgcgagcggcgcgcgggcggggaagcgcggcccagacccccgggtccgcccggagcagctgcgctgtcggggccaggccgggctcccagtggattcgcgggcacagacgcccaggaccgcgctccccacgtggcggagggactggggacccgggcacccgtcctgccccttcaccttccagctccgcctcctccgcgcggaccccgccccgtcccgacccctcccgggtccccggcccagccccctccgggccctcccagcccctccccttcctttccgcggccccgccctctcctcgcggcgcgagtttcaggcagcgctgcgtcctgctgcgcacgtgggaagccctggccccggccacccccgcg BBa_K1722010_sequence 1 ggcccctccctcgggttaccccacagcctaggccgattcgacctctctccgctggggccctcgctggcgtccctgcaccctgggagcgcgagcggcgcgcgggcggggaagcgcggcccagacccccgggtccgcccggagcagctgcgctgtcggggccaggccgggctcccagtggattcgcgggcacagacgcccaggaccgcgctccccacgtggcggagggactggggacccgggcacccgtcctgccccttcaccttccagctccgcctcctccgcgcggaccccgccccgtcccgacccctcccgggtccccggcccagccccctccgggccctcccagcccctccccttcctttccgcggccccgccctctcctcgcggcgcgagtttcaggcagcgctgcgtcctgctgcgcacgtgggaagccctggccccggccacccccgcgtactagagggaaacctgatcatgtagatcgaatggactctaaatccgttcagccgggttagattcccggggtttccgcca BBa_K1722004_sequence 1 ggaaacctgatcatgtagatcgaatggactctaaatccgttcagccgggttagattcccggggtttccgcca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z