BBa_K1722006 1 SV40(en) SV40（with Enhancer） is a widely used strong promoter. 2015-08-31T11:00:00Z 2015-09-07T06:31:40Z SV40 promoter with enhancer was achieved from Shenzhen Second People's Hospital. SV40 is an abbreviation for Simian Virus 40, a polyomavirus that is found in both monkeys and humans. SV40 promoter, which is one of the earliest virus promoter being found by biologists, can improve the gene expression level of many host cells. Similar to 35S promoter, SV40 has a relatively small genetic structure and high expression driving ability. As a strong promoter being widely used in genetic engineering, SV40 has a close affinity with RNA polymerase and can direct the massive synthesizing of mRNA. In our project, we construct SV40 and Renilla luciferase(Rlu) in the same plasmid. By detecting the expression of Rlu, we are able to tell the working efficiency of our system. false false _2142_ 20403 26634 9 false We designed the following primers and amplified SV40 promoter from the vector psi-Check2: By incorporating these primers into hUPII promoter, the promoter is flanked by the iGEM prefix and suffix after amplification. false Zeyu Miao BBa_K1722005 1 Rluc Rluc can express Renilla luciferase（Rluc）. 2015-08-28T11:00:00Z 2016-01-19T01:27:56Z In our experiment, we got the part from Shenzhen Second People's Hospital. Additionally, we did our system's function verification in Shenzhen Second People's Hospital. Rluc can express Renilla luciferase which has become popular as a reporter enzyme for gene expression assays. Renilla luciferase (RLUC)is a blue-light emitting luciferase of marine anthozoan Renilla reniformis [Str].As a reporter gene, rescarchers attach it to a regulatory sequence of another gene of interest in bacteria, cell culture, animals or plants. RLUC is chosen as a reporter because the characteristic it confer on organisms expressing it is easily identified and measured.The bioluminescence of the sea pancy,is under the control of a nerve network and is stimlated by changes of intracellular Ca??﹢ concerntramide，CO₂ andlight(λMax=480nm),as in the following scheme. RLBP is another protein of Renilla reniformis that can luminesce in vivo called Ca??﹢???triggered Renilla luciferin birding protein. 2015 SZU-IGEM construct Rluc with one codon being amber mutated and SV40 ,the promoter in the same plasmid to introduce Rluc into our system.This plasmid with Rluc,together with two other plasmids,are inserted into the cell.Only when the two promoters in plasmids without Rluc are activated simultanuously to express the downstrean DNA sequence can Rluc being translated completely. RLUC that is produced inside the cell catalyzes a reaction with luciferin to produce light. By measuring the light intensity using Luminometer,we can tell the working efficiency of our system under different conditions. false false _2142_ 4206 27226 9 false We designed the following primers and amplified Rluc promoter from the vector psi-Check2:Up: CCGGAATTCTCTAGACTGGCTGCCAAGTAGTAC Down: TGCACTGCAGACTAGTTACTGCTCGTTCTT. By incorporating these primers into Rluc promoter, the promoter is flanked by the iGEM prefix and suffix after amplification. false Kexin Li BBa_K1722012 1 BBa_K1722012 SV40(with Enhancer)+Rluc Composite 2015-09-01T11:00:00Z 2015-09-07T09:04:10Z We achieved both SV40 promoter and Rluc from Shenzhen Second People's Hospital. SV40 is an abbreviation for Simian Virus 40, a polyomavirus that is found in both monkeys and humans. SV40 promoter, which is one of the earliest virus promoter being found by biologists, can improve the gene expression level of many host cells. Similar to 35S promoter, SV40 has a relatively small genetic structure and high expression driving ability. As a strong promoter being widely used in genetic engineering, SV40 has a close affinity with RNA polymerase and can direct the massive synthesizing of mRNA. Different from the SV40 promoter that is already existed in iGEM Distribution kit, this promoter has an enhancer in its sequence. Rluc can express Renilla luciferase which has become popular as a reporter enzyme for gene expression assays. Renilla luciferase(RLUC) is a blue-light emitting luciferase of marine anthozoan Renilla reniformis. As a reporter gene, researchers attach it to a regulatory sequence of another gene of interest in bacteria, cell culture, animals or plants. RLUC is chosen as a reporter because the characteristic it confer on organisms expressing it is easily identified and measured. The bioluminescence of the sea pancy, is under the control of a nerve network and is stimulated by changes of intracellular Ca2+ concerntration. RLUC catalyzes the oxidation of coelenteramide, CO2 and light(480nm）,as in the following scheme. 2015 SZU-iGEM construct SV40 and Rluc with one codon being amber mutated in the same plasmid. This plasmid, together with two other plasmids, are inserted into the cell. Only when the three plasmids work simultanuously can our orthogonal system behave its function, specifically recognise bladder cancer cells and kill them. false false _2142_ 20403 26634 9 false We designed the primers of these two genes and amplified them from the vector psi-Check2, the two genes were then flanked by the iGEM prefix and suffix after amplification. We constructed the two genes in pSB1C3 using 3A Assembly as described in iGEM.org. false Changxing Hu component2442694 1 BBa_K1722006 component2442695 1 BBa_K1722005 annotation2442694 1 BBa_K1722006 range2442694 1 1 419 annotation2442695 1 BBa_K1722005 range2442695 1 426 1361 BBa_K1722006_sequence 1 gcgcagcaccatggcctgaaataacctctgaaagaggaacttggttaggtaccttctgaggcggaaagaaccagctgtggaatgtgtgtcagttagggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctcggcctctgagctattccagaagtagtgaggaggcttttttggaggcctaggcttttgcaaaaagctt BBa_K1722012_sequence 1 gcgcagcaccatggcctgaaataacctctgaaagaggaacttggttaggtaccttctgaggcggaaagaaccagctgtggaatgtgtgtcagttagggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctcggcctctgagctattccagaagtagtgaggaggcttttttggaggcctaggcttttgcaaaaagctttactagatggcttccaagtagtacgaccccgagcaacgcaaacgcatgatcactgggcctcagtggtgggctcgctgcaagcaaatgaacgtgctggactccttcatcaactactatgattccgagaagcacgccgagaacgccgtgatttttctgcatggtaacgctgcctccagctacctgtggaggcacgtcgtgcctcacatcgagcccgtggctagatgcatcatccctgatctgatcggaatgggtaagtccggcaagagcgggaatggctcatatcgcctcctggatcactacaagtacctcaccgcttggttcgagctgctgaaccttccaaagaaaatcatctttgtgggccacgactggggggcttgtctggcctttcactactcctacgagcaccaagacaagatcaaggccatcgtccatgctgagagtgtcgtggacgtgatcgagtcctgggacgagtggcctgacatcgaggaggatatcgccctgatcaagagcgaagagggcgagaaaatggtgcttgagaataacttcttcgtcgagaccatgctcccaagcaagatcatgcggaaactggagcctgaggagttcgctgcctacctggagccattcaaggagaagggcgaggttagacggcctaccctctcctggcctcgcgagatccctctcgttaagggaggcaagcccgacgtcgtccagattgtccgcaactacaacgcctaccttcgggccagcgacgatctgcctaagatgttcatcgagtccgaccctgggttcttttccaacgctattgtcgagggagctaagaagttccctaacaccgagttcgtgaaggtgaagggcctccacttcagccaggaggacgctccagatgaaatgggtaagtacatcaagagcttcgtggagcgcgtgctgaagaacgagcagtaa BBa_K1722005_sequence 1 atggcttccaagtagtacgaccccgagcaacgcaaacgcatgatcactgggcctcagtggtgggctcgctgcaagcaaatgaacgtgctggactccttcatcaactactatgattccgagaagcacgccgagaacgccgtgatttttctgcatggtaacgctgcctccagctacctgtggaggcacgtcgtgcctcacatcgagcccgtggctagatgcatcatccctgatctgatcggaatgggtaagtccggcaagagcgggaatggctcatatcgcctcctggatcactacaagtacctcaccgcttggttcgagctgctgaaccttccaaagaaaatcatctttgtgggccacgactggggggcttgtctggcctttcactactcctacgagcaccaagacaagatcaaggccatcgtccatgctgagagtgtcgtggacgtgatcgagtcctgggacgagtggcctgacatcgaggaggatatcgccctgatcaagagcgaagagggcgagaaaatggtgcttgagaataacttcttcgtcgagaccatgctcccaagcaagatcatgcggaaactggagcctgaggagttcgctgcctacctggagccattcaaggagaagggcgaggttagacggcctaccctctcctggcctcgcgagatccctctcgttaagggaggcaagcccgacgtcgtccagattgtccgcaactacaacgcctaccttcgggccagcgacgatctgcctaagatgttcatcgagtccgaccctgggttcttttccaacgctattgtcgagggagctaagaagttccctaacaccgagttcgtgaaggtgaagggcctccacttcagccaggaggacgctccagatgaaatgggtaagtacatcaagagcttcgtggagcgcgtgctgaagaacgagcagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z