BBa_K1722005 1 Rluc Rluc can express Renilla luciferase（Rluc）. 2015-08-28T11:00:00Z 2016-01-19T01:27:56Z In our experiment, we got the part from Shenzhen Second People's Hospital. Additionally, we did our system's function verification in Shenzhen Second People's Hospital. Rluc can express Renilla luciferase which has become popular as a reporter enzyme for gene expression assays. Renilla luciferase (RLUC)is a blue-light emitting luciferase of marine anthozoan Renilla reniformis [Str].As a reporter gene, rescarchers attach it to a regulatory sequence of another gene of interest in bacteria, cell culture, animals or plants. RLUC is chosen as a reporter because the characteristic it confer on organisms expressing it is easily identified and measured.The bioluminescence of the sea pancy,is under the control of a nerve network and is stimlated by changes of intracellular Ca??﹢ concerntramide，CO₂ andlight(λMax=480nm),as in the following scheme. RLBP is another protein of Renilla reniformis that can luminesce in vivo called Ca??﹢???triggered Renilla luciferin birding protein. 2015 SZU-IGEM construct Rluc with one codon being amber mutated and SV40 ,the promoter in the same plasmid to introduce Rluc into our system.This plasmid with Rluc,together with two other plasmids,are inserted into the cell.Only when the two promoters in plasmids without Rluc are activated simultanuously to express the downstrean DNA sequence can Rluc being translated completely. RLUC that is produced inside the cell catalyzes a reaction with luciferin to produce light. By measuring the light intensity using Luminometer,we can tell the working efficiency of our system under different conditions. false false _2142_ 4206 27226 9 false We designed the following primers and amplified Rluc promoter from the vector psi-Check2:Up: CCGGAATTCTCTAGACTGGCTGCCAAGTAGTAC Down: TGCACTGCAGACTAGTTACTGCTCGTTCTT. By incorporating these primers into Rluc promoter, the promoter is flanked by the iGEM prefix and suffix after amplification. false Kexin Li BBa_K1150011 1 BBa_K1150011 SV40 promoter 2013-09-15T11:00:00Z 2015-05-08T01:09:27Z ... .. false false _1462_ 0 16627 9 In stock false ... false Freiburg 2013 annotation2347620 1 SV40 range2347620 1 1 344 BBa_K1722013 1 SV40+Rluc SV40+Rluc Composite 2015-09-06T11:00:00Z 2015-09-07T09:04:57Z SV40 promoter is achieved from 2015 Distribution Kit(BBa_K1150011). Rluc is achieved from Shenzhen Second People's Hospital. SV40+Rluc, the device that we constructed this year, will perform its function with two other devices hUPll+AckRS(BBa_K1722007) and hTERT+tRNA(BBa_K1722010)/ shTERT+tRNA(BBa_K1722011). SV40 is an abbreviation for Simian Virus 40, a polyomavirus that is found in both monkeys and humans. SV40 promoter, which is one of the earliest virus promoter being found by biologists, can improve the gene expression level of many host cells.[1] Similar to 35S promoter, SV40 has a relatively small genetic structure and high expression driving ability.[2-3] As a strong promoter being widely used in genetic engineering,[4] SV40 has a close affinity with RNA polymerase and can direct the massive synthesizing of mRNA. Different from the SV40 promoter that is already existed in iGEM Distribution kit, this promoter has an enhancer in its sequence. Rluc can express Renilla luciferase which has become popular as a reporter enzyme for gene expression assays. Renilla luciferase(RLUC) is a blue-light emitting luciferase of marine anthozoan Renilla reniformis.[5] As a reporter gene, researchers attach it to a regulatory sequence of another gene of interest in bacteria, cell culture, animals or plants. RLUC is chosen as a reporter because the characteristic it confer on organisms expressing it is easily identified and measured. The bioluminescence of the sea pancy, is under the control of a nerve network[6-8] and is stimulated by changes of intracellular Ca2+ concerntration.[9-11] RLUC catalyzes the oxidation of coelenteramide, CO2 and light(480nm）,as in the following scheme: false false _2142_ 20403 26634 9 false We designed the primer of Rluc and amplified it from the vector psi-Check2, the Rluc gene was then flanked by the iGEM prefix and suffix after amplification. We constructed the two genes in pSB1C3 using 3A Assembly as described in iGEM.org. false Hao Wang component2445584 1 BBa_K1722005 component2445583 1 BBa_K1150011 annotation2445583 1 BBa_K1150011 range2445583 1 1 344 annotation2445584 1 BBa_K1722005 range2445584 1 351 1286 BBa_K1150011_sequence 1 ctgtggaatgtgtgtcagttagggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctcggcctctgagctattccagaagtagtgaggaggcttttttggaggcctaggcttttgcaaaaagct BBa_K1722013_sequence 1 ctgtggaatgtgtgtcagttagggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctcggcctctgagctattccagaagtagtgaggaggcttttttggaggcctaggcttttgcaaaaagcttactagatggcttccaagtagtacgaccccgagcaacgcaaacgcatgatcactgggcctcagtggtgggctcgctgcaagcaaatgaacgtgctggactccttcatcaactactatgattccgagaagcacgccgagaacgccgtgatttttctgcatggtaacgctgcctccagctacctgtggaggcacgtcgtgcctcacatcgagcccgtggctagatgcatcatccctgatctgatcggaatgggtaagtccggcaagagcgggaatggctcatatcgcctcctggatcactacaagtacctcaccgcttggttcgagctgctgaaccttccaaagaaaatcatctttgtgggccacgactggggggcttgtctggcctttcactactcctacgagcaccaagacaagatcaaggccatcgtccatgctgagagtgtcgtggacgtgatcgagtcctgggacgagtggcctgacatcgaggaggatatcgccctgatcaagagcgaagagggcgagaaaatggtgcttgagaataacttcttcgtcgagaccatgctcccaagcaagatcatgcggaaactggagcctgaggagttcgctgcctacctggagccattcaaggagaagggcgaggttagacggcctaccctctcctggcctcgcgagatccctctcgttaagggaggcaagcccgacgtcgtccagattgtccgcaactacaacgcctaccttcgggccagcgacgatctgcctaagatgttcatcgagtccgaccctgggttcttttccaacgctattgtcgagggagctaagaagttccctaacaccgagttcgtgaaggtgaagggcctccacttcagccaggaggacgctccagatgaaatgggtaagtacatcaagagcttcgtggagcgcgtgctgaagaacgagcagtaa BBa_K1722005_sequence 1 atggcttccaagtagtacgaccccgagcaacgcaaacgcatgatcactgggcctcagtggtgggctcgctgcaagcaaatgaacgtgctggactccttcatcaactactatgattccgagaagcacgccgagaacgccgtgatttttctgcatggtaacgctgcctccagctacctgtggaggcacgtcgtgcctcacatcgagcccgtggctagatgcatcatccctgatctgatcggaatgggtaagtccggcaagagcgggaatggctcatatcgcctcctggatcactacaagtacctcaccgcttggttcgagctgctgaaccttccaaagaaaatcatctttgtgggccacgactggggggcttgtctggcctttcactactcctacgagcaccaagacaagatcaaggccatcgtccatgctgagagtgtcgtggacgtgatcgagtcctgggacgagtggcctgacatcgaggaggatatcgccctgatcaagagcgaagagggcgagaaaatggtgcttgagaataacttcttcgtcgagaccatgctcccaagcaagatcatgcggaaactggagcctgaggagttcgctgcctacctggagccattcaaggagaagggcgaggttagacggcctaccctctcctggcctcgcgagatccctctcgttaagggaggcaagcccgacgtcgtccagattgtccgcaactacaacgcctaccttcgggccagcgacgatctgcctaagatgttcatcgagtccgaccctgggttcttttccaacgctattgtcgagggagctaagaagttccctaacaccgagttcgtgaaggtgaagggcctccacttcagccaggaggacgctccagatgaaatgggtaagtacatcaagagcttcgtggagcgcgtgctgaagaacgagcagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z