BBa_K1723001 1 BBa_K1723001 PAM rich URS j23117 promoter 2015-09-07T11:00:00Z 2015-09-08T05:58:31Z This promoter was shipped to us by Dr David Bikard, from the pasteur institute, in the pWJ89 plasmid. PAM rich URS J23117 is a promoter made from the existing J23117 promoter. This promoter has PAM rich Upstream Regulatory Sequence to enable the use of protein dCas9-ω (BBa_K1723000) as a gene transcription regulator when in complex with one sgRNA Z0 (BBa_K1723002), Z35 (BBa_K1723003), or Z4 (BBa_K1723004). All this system is operating in the special cell strain JEN202. In our experiments this promoter is 27 base pairs upstream the ATG start codon, an average of 30bp is recommended. false false _2143_ 26018 26018 9 false PAM rich sequence was a bit shortened comparing to the original promoter in pWJ89 plasmid as it contained one RFC10 restriction site but all the binding sites remains intact. false Emilie Cuillery annotation2446852 1 sgRNA Z0 recognition site range2446852 1 51 70 annotation2446851 1 PAM range2446851 1 71 73 annotation2446853 1 J23117 range2446853 1 50 84 annotation2446848 1 sgRNA Z4 recognition site range2446848 1 16 35 annotation2446849 1 PAM range2446849 1 44 46 annotation2446850 1 sgRNA Z35 recognition site range2446850 1 47 66 annotation2446821 1 PAM range2446821 1 13 15 BBa_K1723001_sequence 1 aggccggatcttccacaacacgcacggtgttacattaggcataccggtcttgacagctagctcagtcctagggattgtgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z