BBa_K1723002 1 BBa_K1723002 sgRNA Z0 expressing cassette 2015-09-14T11:00:00Z 2015-09-15T08:34:58Z This sequence was fully synthesized. This part is expressing the sgRNA (single guide RNA) Z0 that can bind to dCas9-ω; (BBa_K1723000). The complex was designed to bind the PAM rich URS J23117 promoter (BBa_K1723001) to repress the production of the target gene linked to the promoter. This part is a part of a gene regulation system built with dCas9-ω;. with the parts sgRNAZ4 expressing cassette (BBa_K1723003) and gRNA Z35 expressing cassette (BBa_K1723004). This sgRNA coding sequence was biobricked with the promoter pBAD and its terminator, the one we used for our experiments, as its coding sequence has to start the first base after the promoter and so it couldn't be used with the standard biobrick system so the promoter is provided already. It is possible to PCR out the part to put it under another promoter, but he terminator is specific and it is recommended to keep it. false false _2143_ 26018 26018 9 false This part was design on the model for sgRNAs on the paper from Alec AK Nielsen & Christopher A Voigt [3] and the specific sequence for the gRNA Z0 was found with the design of the plasmid pWJ89 D.Bikard [1] sent us. false Emilie Cuillery annotation2456752 1 S. Pyogenes terminator range2456752 1 236 276 annotation2456751 1 sgRNA scaffold range2456751 1 194 235 annotation2456729 1 pBAD promoter range2456729 1 1 173 annotation2456750 1 Z0 specific sequence range2456750 1 174 193 BBa_K1723002_sequence 1 gggaccaaagccatgacaaaaacgcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccatatgacagctagctcagtcctagttttagagctagaaatagcaagttaaaataaggctagtccgattgcaacttgaaaaagtggcaccgagtcggtgcttttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z