BBa_K1723003 1 BBa_K1723003 sgRNA Z4 expressing cassette 2015-09-14T11:00:00Z 2015-09-15T08:53:46Z This sequence was fully synthesized. This part is expressing the sgRNA (single guide RNA) Z4 that can bind to dCas9-ω (BBa_K1723000). The complex was designed to bind the PAM rich URS J23117 promoter (BBa_K1723001) to activate the production of the target gene linked to the promoter. This part is a part of a gene regulation system built with dCas9-ω, with the parts sgRNA Z0 expressing cassette (BBa_K1723002) and gRNA Z35 expressing cassette (BBa_K1723004). This sgRNA coding sequence was biobricked with the promoter pBAD and its terminator, both used for our experiments. As the gRNA sequence has to start the first base after the promoter it couldn't have been used with the standard BioBrick system so the promoter is provided already. It is possible to PCR out the part to put it under another promoter, but he terminator is specific and it is recommended to keep it. false false _2143_ 26018 26018 9 false This part was design on the model for sgRNAs on the paper from Alec AK Nielsen & Christopher A Voigt [3] and the specific sequence for the gRNA Z4 was designed from the sequence of the plasmid pWJ89 D.Bikard [1] sent us. false Emilie Cuillery annotation2456850 1 S. Pyogenes terminator range2456850 1 236 275 annotation2456847 1 pBAD promoter range2456847 1 1 173 annotation2456848 1 Z4 specific sequence range2456848 1 174 193 annotation2456849 1 sgRNA scaffold range2456849 1 194 235 BBa_K1723003_sequence 1 gggaccaaagccatgacaaaaacgcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccatagaagatccggcctgcagccagttttagagctagaaatagcaagttaaaataaggctagtccgattgcaacttgaaaagtggcaccgagtcggtgcttttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z