BBa_K1723004 1 BBa_K1723004 sgRNA Z35 expressing cassette 2015-09-14T11:00:00Z 2015-09-15T10:26:46Z this part was fully synthesized. This part is expressing the sgRNA (single guide RNA) Z0 that can bind to dCas9-ω (BBa_K1723000). The complex was designed to bind the PAM rich URS J23117 promoter (BBa_K1723001) to activate the production of the target gene linked to the promoter. This part is a part of a gene regulation system built with dCas9-ω, with the parts sgRNA Z4 expressing cassette (BBa_K1723003) and gRNA Z35 expressing cassette (BBa_K1723004). This sgRNA coding sequence was biobricked with the promoter pBAD and its terminator, both used for our experiments. As the gRNA sequence has to start the first base after the promoter it couldn't have been used with the standard biobrick system so the promoter is provided already. It is possible to PCR out the part to put it under another promoter, but he terminator is specific and it is recommended to keep it. Discover all the parts that can work with this one: http://2015.igem.org/Team:EPF_Lausanne/Part_Collection false false _2143_ 26018 26018 9 false This part was design on the model for sgRNAs on the paper from Alec AK Nielsen & Christopher A Voigt [3] and the specific sequence for the gRNA Z35 was designed from the sequence of the plasmid pWJ89 D.Bikard [1] sent us. false Emilie Cuillery annotation2457055 1 sgRNA scaffold range2457055 1 193 234 annotation2457056 1 S. Pyogenes terminator range2457056 1 235 274 annotation2457053 1 pBAD promoter range2457053 1 1 172 annotation2457054 1 Z35 specific sequence range2457054 1 173 192 BBa_K1723004_sequence 1 gggaccaaagccatgacaaaaacgcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgtatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataactgagctagctgtcaagacgttttagagctagaaatagcaagttaaaataaggctagtccgattgcaacttgaaaaagtggcaccgagcggtgcttttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z