BBa_K1723005 1 BBa_K1723005 PAM rich URS J23117Alt promoter 2015-09-14T11:00:00Z 2015-09-15T10:48:08Z this part was fully synthesized. PAM rich URS J23117 is a promoter made from the existing PAM rich URS J23117 promoter (BBa_K1723001) and mutated. This promoter has PAM (PAM = NGG sequence) rich Upstream Regulatory Sequence to enable the use of protein dCas9-ω (BBa_K1723000) as a gene transcription regulator when in complex with one sgRNA targeting the promoter such as: X0 (BBa_K1723006), X4 (BBa_K1723007), or X35 (BBa_K1723008). Discover all the parts that can work with this one: http://2015.igem.org/Team:EPF_Lausanne/Part_Collection false false _2143_ 26018 26018 9 false This part was synthesized on the model of the PAM rich URS J23117 promoter. It was obtained by mutating bases on the promoter to obtain different target sites for sgRNAs for promoter regulation using dCas9-ω system. false Emilie Cuillery annotation2457068 1 PAM range2457068 1 189 191 annotation2457070 1 PAM range2457070 1 242 244 annotation2462284 1 -10 sequence range2462284 1 271 276 annotation2457069 1 sgRNA X4 recognition site range2457069 1 192 211 annotation2457072 1 PAM range2457072 1 269 271 annotation2457067 1 J23117Alt range2457067 1 248 282 annotation2462285 1 -35 sequence range2462285 1 248 253 annotation2457071 1 sgRNA X35 recognition site range2457071 1 245 264 annotation2457066 1 PAM rich URS range2457066 1 1 247 annotation2457074 1 sgRNA X0 recognition site range2457074 1 249 268 BBa_K1723005_sequence 1 aagcagaggagcaaaagctcatttctgaagaggacttgttgcggaaacgacgagaacagttgaaacacaaacttgaacagctacggaactcttgtgcgtaaggaaaagtaaggaaaacgattccttctaacagaaatgtcctgagcaatcacctatgaactgtcgactcgagcctctatggattatcaccgtccctcgagaaattgagcgccacaacacgcacggtgttacattaggcataccttcgttgacatgctaaagagatatcgggattgtgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z