BBa_K1723007 1 BBa_K1723007 sgRNA X4 expressing cassette 2015-09-14T11:00:00Z 2015-09-15T11:54:15Z this part was fully synthesized. This part is expressing the sgRNA (single guide RNA) X0 that can bind to dCas9-ω (BBa_K1723000). The complex was designed to bind the PAM rich URS J23117Alt promoter (BBa_K1723005) to repress the production of the target gene linked to the promoter. This part is a part of a gene regulation system built with dCas9-ω, with the parts sgRNA X4 expressing cassette (BBa_K1723006) and gRNA X35 expressing cassette (BBa_K1723008). This sgRNA coding sequence was biobricked with the promoter pBAD and its terminator, both used for our experiments. As the gRNA sequence has to start the first base after the promoter it couldn't have been used with the standard biobrick system so the promoter is provided already. It is possible to PCR out the part to put it under another promoter, but he terminator is specific and it is recommended to keep it. Discover all the parts that can work with this one: http://2015.igem.org/Team:EPF_Lausanne/Part_Collection false false _2143_ 26018 26018 9 false false Emilie Cuillery annotation2457292 1 sgRNA scaffold range2457292 1 194 235 annotation2457289 1 pBAD promoter range2457289 1 1 173 annotation2457311 1 S. Pyogenes terminator range2457311 1 236 276 annotation2457291 1 X4 specific sequence range2457291 1 174 193 BBa_K1723007_sequence 1 gggaccaaagccatgacaaaaacgcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccatagcgctcaatttctcgagggagttttagagctagaaatagcaagttaaaataaggctagtccgattgcaacttgaaaaagtggcaccgagtcggtgcttttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z