BBa_K1723009 1 BBa_K1723009 c3_0 gRNA expressing sequence 2015-09-15T11:00:00Z 2015-09-16T10:51:41Z Synthesized The c3_0 guide RNA (gRNA) consists of the 20 base pair specificity determinent sequence (SDS) c3_0 followed by a gRNA scaffold that stabilizes the RNA complex. The gRNA is flanked by two self-cleaving ribozymes: a Hammerhead Ribozyme and a HDV Ribozyme thus freeing the gRNA from the rest of the RNA transcript. Then, the gRNA can form a complex with dCas9-VP64 (or any other Cas9 mutant). The complex c3_0-dCas9_VP64 will bind to any GTACATACAGTAGGATCCTA sequence in the genome of the host organism situated directly before a PAM sequence (NGG). false false _2143_ 25334 25334 9 false The c3_0 gRNA - dCas9_VP64 complex works as an activator of the RNA polymerase II CYC_0 promoter. The Hammerhead ribozyme - gRNA - HDV rizobyme sequence design allows to express gRNAs using RNA polymerase II, thus making it possible to chain the expression of gRNAs (by activating another RNA polymerase II promoter which can express another gRNA e.g.). false Cyril Pulver annotation2461240 1 c3_0 SDS range2461240 1 44 63 annotation2461244 1 gRNA scaffold range2461244 1 64 139 annotation2461235 1 Hammerhead Ribozyme range2461235 1 1 43 annotation2461247 1 HDV Ribozyme range2461247 1 144 211 BBa_K1723009_sequence 1 cgactactgatgagtccgtgaggacgaaacgagtaagctcgtcgtacatacagtaggatcctagttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttggccggcatggtcccagcctcctcgctggcgccggctgggcaacatgcttcggcatggcgaatgggac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z