BBa_K1723022 1 BBa_K1723022 CYC_0 promoter 2015-09-16T11:00:00Z 2015-09-17T01:36:09Z Synthesized as a G-Block CYC_0 is the pCYC Yeast Promoter (BBa_K124000) preceded by a PAM sequence (NGG) rich region that allows binding of dCas9_VP64 together with the appropriate guide RNA (gRNA) to 20 base pair specificity determinant sequences flanked by PAM sequences. It is activated by binding of the complex formed of dCas9_VP64 (BBa_K1723021) and c3_0 gRNA (produced by BBa_K1723009): recruitment of RNA polymerase II by the VP64 subunit on the promoter will express a downstream gene. It is inhibited by binding of the complex formed of dCas9_VP64 and c6_0 gRNA (produced by BBa_K1723013): the complex will sterically prevent RNA polymerase II from binding to the promoter. It is inhibited through the same mechanism by binding of the complex formed of dCas9_VP64 and c7_0 gRNA (produced by BBa_K1723017). If any combination of those complexes is expressed, the promoter will be inhibited [1]. To learn more about how this part was used specific to our project, please follow this link: http://2015.igem.org/Team:EPF_Lausanne/Part_Collection false false _2143_ 25334 25334 9 false This promoter was specifically designed to be controlled by complexes constituted of dCas9_VP64 and gRNAs c3_0, c6_0 and c7_0. Since it has been demonstrated that inhibition prevails over activation when combining the co-expression of dCas9_VP64 and those gRNAs [1], this promoter can be used as a basic cellular computation tool. false Cyril Pulver annotation2466904 1 c3_0 activation site range2466904 1 39 58 annotation2466907 1 c6_0 inhibition site range2466907 1 126 145 annotation2466905 1 c7_0 inhibition site range2466905 1 58 77 BBa_K1723022_sequence 1 aagcttgatatcgaattcctgcagcccgggtactgtatgtacatacagtaggatcctatggcatgcatgtgctctgtatgtatataaaactcttgttttcttcttttctctaaatattctttccttatacattaggacctttgcagcataaattactatacttctatagacacacaaacacaaatacacacactaatctagatattaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z