BBa_K1723023 1 BBa_K1723023 CYC_1 promoter 2015-09-17T11:00:00Z 2015-09-18T12:52:02Z Synthesized as a G-Block CYC_1 is a mutated version of the pCYC Yeast Promoter (BBa_K124000) preceded by a PAM sequence rich region (NGG) that allows binding of dCas9_VP64 together with the appropriate guide RNA (gRNA) to 20 base pair specificity determinant sequences flanked by a PAM sequence. It is activated by binding of the complex formed of dCas9_VP64 (BBa_K1723021) and c3_1 gRNA (produced by BBa_K1723010): recruitment of RNA polymerase II by the VP64 subunit on the promoter will express a downstream gene. It is inhibited by binding of the complex formed of dCas9_VP64 and c6_1 gRNA (produced by BBa_K1723014): the complex will sterically prevent RNA polymerase II from binding to the promoter. It is inhibited through the same mechanism by binding of the complex formed of dCas9_VP64 and c7_1 gRNA (produced by BBa_K1723018). If any combination of those complexes is expressed, the promoter will be inhibited. A similar mechanism has been proven to work with CYC_0 (BBa_K1723022) and gRNAs c3_0 (produced by BBa_K1723009), c6_0 (produced by BBa_K1723013) and c7_0 (produced by BBa_K172017) [1]. To learn more about how this part was used specific to our project, please follow this link: http://2015.igem.org/Team:EPF_Lausanne/Part_Collection To learn more about how this part was used specific to our project, please follow this link: http://2015.igem.org/Team:EPF_Lausanne/Part_Collection false false _2143_ 25334 25334 9 false This promoter was specifically designed to be controlled by complexes constituted of dCas9_VP64 and gRNAs c3_1, c6_1 and c7_1. The design of the promoter is based on promoter CYC_0 (BBa_K1723022). It shows specific mutations that make c3_1, c6_1 and c7_1 sites differ from c3_0, c6_0 and c7_0 sites which are present on CYC_0. Since it has been demonstrated with CYC_0 that inhibition prevails over activation when combining the co-expression of dCas9_VP64 and those gRNAs [1], this promoter can be used as a basic cellular computation tool. Mutations were carefully designed to keep both TATA boxes of CYC_0 intact. false Cyril Pulver annotation2469663 1 c6_1 range2469663 1 126 145 annotation2469660 1 c3_1 range2469660 1 39 58 annotation2469661 1 c7_1 range2469661 1 58 77 BBa_K1723023_sequence 1 aagcttgatatcgaattcctgcagcccgggtactgtatccgcagtactattgtacctatggcctcgtaacacacagcatgtatataaaactcttgttttcttcttttctctaaatattctttccttatacattgaatattctaatgcataaattactatacttctatagacacacaaacacaaatacacacactaatctagatattaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z