BBa_K1723024 1 BBa_K1723024 CYC_2 promoter 2015-09-17T11:00:00Z 2015-09-18T01:06:40Z Synthesized as a G-Block CYC_2 is a mutated version of the pCYC Yeast Promoter (BBa_K124000) preceded by a PAM sequence rich region (NGG) that allows binding of dCas9_VP64 together with the appropriate guide RNA (gRNA) to 20 base pair specificity determinant sequences flanked by a PAM sequence. It is activated by binding of the complex formed of dCas9_VP64 (BBa_K1723021) and c3_2 gRNA (produced by BBa_K1723011): recruitment of RNA polymerase II by the VP64 subunit on the promoter will express a downstream gene. It is inhibited by binding of the complex formed of dCas9_VP64 and c6_2 gRNA (produced by BBa_K1723015): the complex will sterically prevent RNA polymerase II from binding to the promoter. It is inhibited through the same mechanism by binding of the complex formed of dCas9_VP64 and c7_2 gRNA (produced by BBa_K1723019). If any combination of those complexes is expressed, the promoter will be inhibited. A similar mechanism has been proven to work with CYC_0 (BBa_K1723022) and gRNAs c3_0 (produced by BBa_K1723009), c6_0 (produced by BBa_K1723013) and c7_0 (produced by BBa_K172017) [1]. To learn more about how this part was used specific to our project, please follow this link: http://2015.igem.org/Team:EPF_Lausanne/Part_Collection false false _2143_ 25334 25334 9 false This promoter was specifically designed to be controlled by complexes constituted of dCas9_VP64 and gRNAs c3_2, c6_2 and c7_2. The design of the promoter is based on promoter CYC_0 (BBa_K1723022). It shows specific mutations that make c3_2, c6_2 and c7_2 sites differ from c3_0, c6_0 and c7_0 sites which are present on CYC_0. Since it has been demonstrated with CYC_0 that inhibition prevails over activation when combining the co-expression of dCas9_VP64 and those gRNAs [1], this promoter can be used as a basic cellular computation tool. Mutations were carefully designed to keep both TATA boxes of CYC_0 intact. false Cyril Pulver annotation2469844 1 c3_2 range2469844 1 39 58 annotation2469847 1 c7_2 range2469847 1 58 77 annotation2469849 1 C6_2 range2469849 1 126 145 BBa_K1723024_sequence 1 aagcttgatatcgaattcctgcagcccgggtactgtatatatacccctgcataccctatggtcggaagatctagaatatgtatataaaactcttgttttcttcttttctctaaatattctttccttatacattgcctgaaccgccgcataaattactatacttctatagacacacaaacacaaatacacacactaatctagatattaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z