BBa_K1725000 1 P-phlF PhlF repressible promoter 2015-08-05T11:00:00Z 2016-07-23T11:16:25Z From "Genomic Mining of Prokaryotic Repressors for Orthogonal Logic Gates" Stanton et al http://www.nature.com/nchembio/journal/v10/n2/full/nchembio.1411.html The promoter is on normally, and off when the PhlF repressor (K1725041) is bound to it. We measured the strength of the promoter with GFP and two different ribosome binding sites (B0032 and B0034), and compared to R0040 and K1725020. false false _2146_ 27285 27284 9 true We used the promotor sequence from "Genomic Mining of Prokaryotic Repressors for Orthogonal Logic Gates" Stanton et al http://www.nature.com/nchembio/journal/v10/n2/full/nchembio.1411.html They based the promoter sequence on J23119, then overlapped the operator sequence of the PhlF repressor over the -10 site. false Mhairi Davidson annotation2476167 1 -10 site range2476167 1 37 42 annotation2476166 1 -35 site range2476166 1 14 19 annotation2461855 1 K1725040 operator sequence range2461855 1 19 48 BBa_K1725000_sequence 1 gattcgttaccaattgacatgatacgaaacgtaccgtatcgttaaggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z