BBa_K1725020 1 P-srpR SrpR repressible promoter 2015-08-06T11:00:00Z 2015-09-18T03:58:50Z From "Genomic Mining of Prokaryotic Repressors for Orthogonal Logic Gates" Stanton et al http://www.nature.com/nchembio/journal/v10/n2/full/nchembio.1411.html The promoter is on normally, and off when the SrpR repressor (K1725061) is bound to it. We measured the strength of the promoter with GFP and two different ribosome binding sites (B0032 and B0034), and compared to R0040 and K1725000. false false _2146_ 20827 27284 9 false We used the promotor sequence from "Genomic Mining of Prokaryotic Repressors for Orthogonal Logic Gates" Stanton et al http://www.nature.com/nchembio/journal/v10/n2/full/nchembio.1411.html They based the promoter sequence on J23119, then overlapped the operator sequence of the SrpR repressor over the -10 site. false Mhairi Davidson annotation2461859 1 K1725060 operator sequence range2461859 1 38 67 BBa_K1725020_sequence 1 gattcgttaccaattgacagctagctcagtcctaggtatatacatacatgcttgtttgtttgtaaac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z