BBa_K1725420 1 UirR UirR (UV intensity response Regulator) 2015-09-07T11:00:00Z 2015-09-08T06:52:10Z The regulator comes from the genomic sequence of the unicellular cyanobacterium Synechocystis sp. PCC6803 UirR is a protein that attaches itself to the transmembrane protein UirS (K1725410). After exposure to unidirectional UV-A, UirS releases UirR, which physically interacts with the lsiR promoter (K1725400), activating transcription. All three parts are required for a cell to respond to the UV-A stimulus. false false _2146_ 21308 21308 9 false Due to the length of the DNA sequence, the gene was amplified via PCR and the BioBrick suffix and prefix were added as part of the primers. The last base of the gene was changed from G to A because different stop codons can be more efficient in different species and TAA is especially efficient in E. coli. false Andrey Filipov BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1710 1 RBS range1710 1 7 10 annotation1709 1 RBS-3\Weak range1709 1 1 13 BBa_K1725421 1 BBa_K1725421 RBS + UirR 2015-09-07T11:00:00Z 2016-01-25T11:31:22Z UirR comes from the genomic sequence of the unicellular cyanobacterium Synechocystis sp. PCC6803. The regulator (K1725420) that participates together with PlsiR (K1725400) and UirS (K1725410) to activate a response to UV-A light has been put downstream of the RBS B0032. false false _2146_ 4206 21308 9 false Due to the length of the DNA sequence, the gene was amplified via PCR and the BioBrick suffix and prefix, alongside with the RBS, were added as part of the primers. The last base of the gene was changed from G to A because different stop codons can be more efficient in different species and TAA is especially efficient in E. coli. false Andrey Filipov component2447022 1 BBa_K1725420 component2447020 1 BBa_B0032 annotation2447020 1 BBa_B0032 range2447020 1 1 13 annotation2447022 1 BBa_K1725420 range2447022 1 20 745 BBa_B0032_sequence 1 tcacacaggaaag BBa_K1725421_sequence 1 tcacacaggaaagtactagatggtaaccaaaatactgattgtagaggatgaaaggctagtggcccaacacattgcccaattattaaaaagtgatggctatgaaatttgtgtgatcgccagtgatggagcaacggcgctgaaaaaaattgctgagttttatccagatctagttttactagatattcgtattaaaggagagatcgacgggatagaggtggcggaacggataaaatctctttactccatccccattgtttatctcacagctttttctgatggggaaaccctggagcgggcccagaaaaccaatccccagggctatgtgattaagccttttcggcgggaacaactattatccaccgtggcgatcgccatagccaatcatcaacagcaacgaaaacctgaggaagataccctctccacgtcaacgggccattatcgcctgcaaccgactttggactatatcgaagagcatctcgaccaaggaattaccgttgaatttctggccggggcgatcggcatgagcacagcctacttttgtcgctttttccaaaaggaaatgggatgttccccctatcaatttattatccaacaacgggttgagcgggccaaagccatactactggaaagagaattgtccattagcgaagtagctttgagatgcggcttcagttcccacagtcaacttaaccaccattttcgtaatctcttgggcattaccccgaaagaatatcgtagtcgctaa BBa_K1725420_sequence 1 atggtaaccaaaatactgattgtagaggatgaaaggctagtggcccaacacattgcccaattattaaaaagtgatggctatgaaatttgtgtgatcgccagtgatggagcaacggcgctgaaaaaaattgctgagttttatccagatctagttttactagatattcgtattaaaggagagatcgacgggatagaggtggcggaacggataaaatctctttactccatccccattgtttatctcacagctttttctgatggggaaaccctggagcgggcccagaaaaccaatccccagggctatgtgattaagccttttcggcgggaacaactattatccaccgtggcgatcgccatagccaatcatcaacagcaacgaaaacctgaggaagataccctctccacgtcaacgggccattatcgcctgcaaccgactttggactatatcgaagagcatctcgaccaaggaattaccgttgaatttctggccggggcgatcggcatgagcacagcctacttttgtcgctttttccaaaaggaaatgggatgttccccctatcaatttattatccaacaacgggttgagcgggccaaagccatactactggaaagagaattgtccattagcgaagtagctttgagatgcggcttcagttcccacagtcaacttaaccaccattttcgtaatctcttgggcattaccccgaaagaatatcgtagtcgctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z