BBa_K1725421 1 BBa_K1725421 RBS + UirR 2015-09-07T11:00:00Z 2016-01-25T11:31:22Z UirR comes from the genomic sequence of the unicellular cyanobacterium Synechocystis sp. PCC6803. The regulator (K1725420) that participates together with PlsiR (K1725400) and UirS (K1725410) to activate a response to UV-A light has been put downstream of the RBS B0032. false false _2146_ 4206 21308 9 false Due to the length of the DNA sequence, the gene was amplified via PCR and the BioBrick suffix and prefix, alongside with the RBS, were added as part of the primers. The last base of the gene was changed from G to A because different stop codons can be more efficient in different species and TAA is especially efficient in E. coli. false Andrey Filipov component2447020 1 BBa_B0032 component2447022 1 BBa_K1725420 annotation2447022 1 BBa_K1725420 range2447022 1 20 745 annotation2447020 1 BBa_B0032 range2447020 1 1 13 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_K1725423 1 BBa_K1725423 J23110 + RBS + UirR 2015-09-07T11:00:00Z 2015-09-16T07:37:56Z The regulator comes from the genomic sequence of the unicellular cyanobacterium Synechocystis sp. PCC6803. The UV intensity response regulator coding sequence was placed downstream of J23110, a constitutive promoter family member. false false _2146_ 21308 21308 9 false The regulator was ligated to J23110 (which came in the form of an annealed oligo) after restriction that was followed by an Azure-A-based gel extraction. false Andrey Filipov component2447059 1 BBa_K1725421 component2447054 1 BBa_J23110 annotation2447059 1 BBa_K1725421 range2447059 1 44 788 annotation2447054 1 BBa_J23110 range2447054 1 1 35 BBa_K1725420 1 UirR UirR (UV intensity response Regulator) 2015-09-07T11:00:00Z 2015-09-08T06:52:10Z The regulator comes from the genomic sequence of the unicellular cyanobacterium Synechocystis sp. PCC6803 UirR is a protein that attaches itself to the transmembrane protein UirS (K1725410). After exposure to unidirectional UV-A, UirS releases UirR, which physically interacts with the lsiR promoter (K1725400), activating transcription. All three parts are required for a cell to respond to the UV-A stimulus. false false _2146_ 21308 21308 9 false Due to the length of the DNA sequence, the gene was amplified via PCR and the BioBrick suffix and prefix were added as part of the primers. The last base of the gene was changed from G to A because different stop codons can be more efficient in different species and TAA is especially efficient in E. coli. false Andrey Filipov BBa_J23110 1 BBa_J23110 constitutive promoter family member 2006-08-16T11:00:00Z 2015-08-31T04:08:40Z Later Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1725427 1 BBa_K1725427 J23110 + RBS + UirR + B0015 2015-09-07T11:00:00Z 2015-09-16T07:37:13Z The regulator comes from the genomic sequence of the unicellular cyanobacterium Synechocystis sp. PCC6803. The UV intensity response regulator coding sequence was positioned downstream of J23110, a constitutive promoter family member, and upstream of the double terminator B0015. This allows the part to be placed in front of other parts with weaker or non-constitutive promoters. false false _2146_ 21308 21308 9 false The regulator and J23110 were ligated to B0015 after restriction that was followed by an Azure-A-based gel extraction. false Andrey Filipov component2447240 1 BBa_B0015 component2447233 1 BBa_K1725423 annotation2447233 1 BBa_K1725423 range2447233 1 1 788 annotation2447240 1 BBa_B0015 range2447240 1 797 925 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1710 1 RBS range1710 1 7 10 annotation1709 1 RBS-3\Weak range1709 1 1 13 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1725427_sequence 1 tttacggctagctcagtcctaggtacaatgctagctactagagtcacacaggaaagtactagatggtaaccaaaatactgattgtagaggatgaaaggctagtggcccaacacattgcccaattattaaaaagtgatggctatgaaatttgtgtgatcgccagtgatggagcaacggcgctgaaaaaaattgctgagttttatccagatctagttttactagatattcgtattaaaggagagatcgacgggatagaggtggcggaacggataaaatctctttactccatccccattgtttatctcacagctttttctgatggggaaaccctggagcgggcccagaaaaccaatccccagggctatgtgattaagccttttcggcgggaacaactattatccaccgtggcgatcgccatagccaatcatcaacagcaacgaaaacctgaggaagataccctctccacgtcaacgggccattatcgcctgcaaccgactttggactatatcgaagagcatctcgaccaaggaattaccgttgaatttctggccggggcgatcggcatgagcacagcctacttttgtcgctttttccaaaaggaaatgggatgttccccctatcaatttattatccaacaacgggttgagcgggccaaagccatactactggaaagagaattgtccattagcgaagtagctttgagatgcggcttcagttcccacagtcaacttaaccaccattttcgtaatctcttgggcattaccccgaaagaatatcgtagtcgctaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1725421_sequence 1 tcacacaggaaagtactagatggtaaccaaaatactgattgtagaggatgaaaggctagtggcccaacacattgcccaattattaaaaagtgatggctatgaaatttgtgtgatcgccagtgatggagcaacggcgctgaaaaaaattgctgagttttatccagatctagttttactagatattcgtattaaaggagagatcgacgggatagaggtggcggaacggataaaatctctttactccatccccattgtttatctcacagctttttctgatggggaaaccctggagcgggcccagaaaaccaatccccagggctatgtgattaagccttttcggcgggaacaactattatccaccgtggcgatcgccatagccaatcatcaacagcaacgaaaacctgaggaagataccctctccacgtcaacgggccattatcgcctgcaaccgactttggactatatcgaagagcatctcgaccaaggaattaccgttgaatttctggccggggcgatcggcatgagcacagcctacttttgtcgctttttccaaaaggaaatgggatgttccccctatcaatttattatccaacaacgggttgagcgggccaaagccatactactggaaagagaattgtccattagcgaagtagctttgagatgcggcttcagttcccacagtcaacttaaccaccattttcgtaatctcttgggcattaccccgaaagaatatcgtagtcgctaa BBa_B0032_sequence 1 tcacacaggaaag BBa_K1725423_sequence 1 tttacggctagctcagtcctaggtacaatgctagctactagagtcacacaggaaagtactagatggtaaccaaaatactgattgtagaggatgaaaggctagtggcccaacacattgcccaattattaaaaagtgatggctatgaaatttgtgtgatcgccagtgatggagcaacggcgctgaaaaaaattgctgagttttatccagatctagttttactagatattcgtattaaaggagagatcgacgggatagaggtggcggaacggataaaatctctttactccatccccattgtttatctcacagctttttctgatggggaaaccctggagcgggcccagaaaaccaatccccagggctatgtgattaagccttttcggcgggaacaactattatccaccgtggcgatcgccatagccaatcatcaacagcaacgaaaacctgaggaagataccctctccacgtcaacgggccattatcgcctgcaaccgactttggactatatcgaagagcatctcgaccaaggaattaccgttgaatttctggccggggcgatcggcatgagcacagcctacttttgtcgctttttccaaaaggaaatgggatgttccccctatcaatttattatccaacaacgggttgagcgggccaaagccatactactggaaagagaattgtccattagcgaagtagctttgagatgcggcttcagttcccacagtcaacttaaccaccattttcgtaatctcttgggcattaccccgaaagaatatcgtagtcgctaa BBa_J23110_sequence 1 tttacggctagctcagtcctaggtacaatgctagc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1725420_sequence 1 atggtaaccaaaatactgattgtagaggatgaaaggctagtggcccaacacattgcccaattattaaaaagtgatggctatgaaatttgtgtgatcgccagtgatggagcaacggcgctgaaaaaaattgctgagttttatccagatctagttttactagatattcgtattaaaggagagatcgacgggatagaggtggcggaacggataaaatctctttactccatccccattgtttatctcacagctttttctgatggggaaaccctggagcgggcccagaaaaccaatccccagggctatgtgattaagccttttcggcgggaacaactattatccaccgtggcgatcgccatagccaatcatcaacagcaacgaaaacctgaggaagataccctctccacgtcaacgggccattatcgcctgcaaccgactttggactatatcgaagagcatctcgaccaaggaattaccgttgaatttctggccggggcgatcggcatgagcacagcctacttttgtcgctttttccaaaaggaaatgggatgttccccctatcaatttattatccaacaacgggttgagcgggccaaagccatactactggaaagagaattgtccattagcgaagtagctttgagatgcggcttcagttcccacagtcaacttaaccaccattttcgtaatctcttgggcattaccccgaaagaatatcgtagtcgctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z