BBa_K1727001 1 BBa_K1727001 Epinecidin-1 (Epinephelus coioides) 2015-09-01T11:00:00Z 2015-09-09T09:03:46Z Epinecidin-1 is the genomic sequence for the skin mucus of Epinephelus coioides. Antibiotic is the method of choice to fight bacterial infection. However due to over use of antibiotics drug-resistant bacteria frequently appear. Making recovery difficult. Nowadays more and more focuses put on new infectious agents to fight with these pathogens. Epinecidin-1 is a kind of antimicrobial peptide. This AMP is extracted from the skin mucus of Epinephelus coioides, respectively. Epinecidin-1 has been shown to help wound healing. false false _2148_ 25489 25489 9 true We use PQE60 as vector,so we design restriction enzyme site Bagl II at N-terminal and BamHI at C-terminal. false Ying Kuan annotation2443815 1 Restriction enzyme BamH I site range2443815 1 1 6 annotation2443817 1 Epinecidin-1 range2443817 1 7 210 annotation2443816 1 Restriction enzyme Bgl lI site range2443816 1 211 216 BBa_K1727001_sequence 1 ggatccatgaggtgcatcgccctctttcttgtgttgtcgctggtggtcctcatggctgaacccggggagggttttatcttccacatcattaaaggactctttcacgctggcaagatgatccatggacttgtcaccaggagacgacatggcgtggaagagctgcaagacctggaccaacgtgcctttgaacgagagaaagcttttgcctgaagatct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z