BBa_K1727002 1 BBa_K1727002 Signal peptide (S.lividans chitinase C) 2015-09-01T11:00:00Z 2015-09-18T09:35:02Z This part is a coding gene of S.lividans chitinase. A signal peptide has ability to carry target protein go through periplasmic space and secret target protein to culture medium. And this system is work in Ecoli. false false _2148_ 25489 25489 9 true The signal peptide will carry pre-mature peptide go through periplasmic space. When pass through the space peptidase will separate signal peptide from target protein. false Ying Kuan annotation2443834 1 Alanine cutting site range2443834 1 91 93 annotation2443821 1 signal peptide range2443821 1 1 90 BBa_K1727002_sequence 1 atgggctttcgtcataaagcggcggcgctggcggcgaccctggcgctgccgctggcgggcctggtgggcctggcgagcccggcgcaggcggcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z