BBa_K1727005 1 BBa_K1727005 Signiferin (Crinia signifera) 2015-09-04T11:00:00Z 2016-02-03T10:48:14Z Signiferin with signal peptide is artificial synthesis. Antimicrobial peptides (AMPs) are stable peptides that have extensive ability to kill or inhibit the growth of bacteria. They play a role in defense mechanism for all organisms, ranging from prokaryotes to humans, to against predators. Some of them act against specific strain of microbes. Signiferin is a kinds of antimicrobial peptide extracted from the skin mucus of Crinia signifera, respectively. It demonstrated effectiveness in killing MRSA. And we had change it's sequence into E.coli codon usage. We treat a signal peptide in front of signiferin. This signal peptide comes from S.lividas and has ability to let E.coli secrect signiferin to LB culture medium. We used Lac operator,RBS,terminator on pQE60 to made our expression machine worked. false false _2148_ 4206 25489 9 Not in stock false PQE false Ying Kuan annotation2454863 1 Signiferin range2454863 1 1 54 BBa_K1727005_sequence 1 attattggccatctgattaaaaccgcgctgggcatgctgggcctgtaataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z