BBa_K1727000 1 BBa_K1727000 Signiferin with signal peptide 2015-09-01T11:00:00Z 2016-02-03T10:04:50Z We synthesis this sequence from IDT (Integrated device technology) company. Antimicrobial peptides (AMPs) are stable peptides that have extensive ability to kill or inhibit the growth of bacteria. They play a role in defense mechanism for all organisms, ranging from prokaryotes to humans, to against predators. Some of them act against specific strain of microbes. Signiferin is a kinds of antimicrobial peptide extracted from the skin mucus of Crinia signifera, respectively. It demonstrated effectiveness in killing MRSA. And we had change it's sequence into E.coli codon usage. We treat a signal peptide in front of signiferin. This signal peptide comes from S.lividas and has ability to let E.coli secrect signiferin to LB culture medium. false false _2148_ 4206 25489 9 true We had change signiferin sequence into E.coli codon usage. In order to get the antimicrobial peptide easily we treat signal peptide in front of the AMP. false Ying Kuan annotation2473447 1 Restriction enzyme site BamH I range2473447 1 173 179 annotation2473435 1 Restriction enzyme site Nco I range2473435 1 1 6 annotation2473436 1 signal peptide range2473436 1 7 104 annotation2473437 1 Signiferin range2473437 1 105 173 BBa_K1727006 1 BBa_K1727006 Lac operator+RBS+Signal peptide+Signiferin+Terminator 2015-09-04T11:00:00Z 2016-02-03T10:05:22Z Signiferin with signal peptide is artificial synthesis. Antimicrobial peptides (AMPs) are stable peptides that have extensive ability to kill or inhibit the growth of bacteria. They play a role in defense mechanism for all organisms, ranging from prokaryotes to humans, to against predators. Some of them act against specific strain of microbes. Signiferin is a kinds of antimicrobial peptide extracted from the skin mucus of Crinia signifera, respectively. It demonstrated effectiveness in killing MRSA. And we had change it's sequence into E.coli codon usage. We treat a signal peptide in front of signiferin. This signal peptide comes from S.lividas and has ability to let E.coli secrect signiferin to LB culture medium. We used Lac operator,RBS,terminator on pQE60 to made our expression machine worked. true false _2148_ 4206 25489 9 false PQE false Ying Kuan component2444073 1 BBa_K1727000 annotation2444073 1 BBa_K1727000 range2444073 1 1 179 BBa_K1727006_sequence 1 ctcgaggaattcccatgggctttcgtcataaagcggcggcgctggcggcgaccctggcgctgccgctggcgggcctggtgggcctggcgagcccggcgcaggcggcgattattggccatctgattaaaaccgcgctgggcatgctgggcctgtaataataaggatccctgcagtctaga BBa_K1727000_sequence 1 ctcgaggaattcccatgggctttcgtcataaagcggcggcgctggcggcgaccctggcgctgccgctggcgggcctggtgggcctggcgagcccggcgcaggcggcgattattggccatctgattaaaaccgcgctgggcatgctgggcctgtaataataaggatccctgcagtctaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z